Incidental Mutation 'R1657:Celsr3'
ID186470
Institutional Source Beutler Lab
Gene Symbol Celsr3
Ensembl Gene ENSMUSG00000023473
Gene Namecadherin, EGF LAG seven-pass G-type receptor 3
SynonymsFmi1, flamingo
MMRRC Submission 039693-MU
Accession Numbers

Genbank: NM_080437; MGI: 1858236 

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108826320-108852969 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 108842952 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 2512 (C2512*)
Ref Sequence ENSEMBL: ENSMUSP00000150759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024238] [ENSMUST00000194079] [ENSMUST00000213524]
Predicted Effect probably null
Transcript: ENSMUST00000024238
AA Change: C2505*
SMART Domains Protein: ENSMUSP00000024238
Gene: ENSMUSG00000023473
AA Change: C2505*

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
low complexity region 264 293 N/A INTRINSIC
CA 338 422 2.25e-27 SMART
CA 446 534 5.05e-30 SMART
CA 558 640 7.6e-25 SMART
CA 664 745 7.36e-32 SMART
CA 769 847 5.95e-18 SMART
CA 871 950 5.25e-28 SMART
CA 974 1056 2.67e-29 SMART
CA 1080 1158 1.18e-21 SMART
CA 1186 1262 3.2e-1 SMART
low complexity region 1328 1335 N/A INTRINSIC
low complexity region 1350 1360 N/A INTRINSIC
EGF 1369 1424 1.02e-2 SMART
EGF 1429 1464 3.23e0 SMART
EGF 1467 1503 8.78e-2 SMART
LamG 1524 1691 2.27e-35 SMART
EGF 1714 1747 4.22e-4 SMART
LamG 1774 1913 9.02e-21 SMART
EGF 1938 1971 2.43e-4 SMART
EGF 1973 2009 1.3e-4 SMART
EGF_Lam 2066 2111 5.08e-7 SMART
HormR 2114 2176 3.42e-21 SMART
Pfam:GAIN 2188 2441 1.1e-57 PFAM
GPS 2467 2520 7.92e-20 SMART
Pfam:7tm_2 2527 2758 1.5e-56 PFAM
low complexity region 2813 2829 N/A INTRINSIC
low complexity region 2882 2906 N/A INTRINSIC
low complexity region 3058 3072 N/A INTRINSIC
low complexity region 3149 3189 N/A INTRINSIC
low complexity region 3239 3261 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175326
Predicted Effect probably benign
Transcript: ENSMUST00000194079
SMART Domains Protein: ENSMUSP00000141789
Gene: ENSMUSG00000023473

DomainStartEndE-ValueType
Pfam:7tm_2 1 185 6.9e-45 PFAM
low complexity region 240 256 N/A INTRINSIC
low complexity region 309 333 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195857
Predicted Effect probably null
Transcript: ENSMUST00000213524
AA Change: C2512*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the flamingo subfamily, which is included in the cadherin superfamily. The flamingo cadherins consist of nonclassic-type cadherins that do not interact with catenins. They are plasma membrane proteins containing seven epidermal growth factor-like repeats, nine cadherin domains and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic feature of their subfamily. The encoded protein may be involved in the regulation of contact-dependent neurite growth and may play a role in tumor formation. [provided by RefSeq, Jun 2013]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, abnormal neurvous system development, and abnormal respiratory system development. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Celsr3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Celsr3 APN 9 108848925 missense probably damaging 1.00
IGL00536:Celsr3 APN 9 108829192 missense probably benign 0.33
IGL00552:Celsr3 APN 9 108841263 missense possibly damaging 0.88
IGL00801:Celsr3 APN 9 108842576 missense probably benign
IGL01420:Celsr3 APN 9 108841190 critical splice acceptor site probably null
IGL01541:Celsr3 APN 9 108831708 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108834557 missense probably damaging 1.00
IGL01619:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01631:Celsr3 APN 9 108837404 missense probably benign 0.00
IGL01777:Celsr3 APN 9 108835942 missense probably benign 0.08
IGL01938:Celsr3 APN 9 108828415 missense probably benign 0.34
IGL02135:Celsr3 APN 9 108827556 missense probably benign 0.11
IGL02231:Celsr3 APN 9 108842510 missense probably damaging 1.00
IGL02234:Celsr3 APN 9 108829960 missense probably benign
IGL02392:Celsr3 APN 9 108834721 splice site probably benign
IGL02416:Celsr3 APN 9 108832119 missense probably damaging 1.00
IGL02421:Celsr3 APN 9 108840463 missense probably damaging 1.00
IGL02455:Celsr3 APN 9 108842893 missense probably benign 0.15
IGL02798:Celsr3 APN 9 108843575 missense probably damaging 1.00
IGL02939:Celsr3 APN 9 108849453 missense probably damaging 1.00
IGL02947:Celsr3 APN 9 108845935 missense probably benign 0.12
IGL02986:Celsr3 APN 9 108841255 unclassified probably null
IGL03089:Celsr3 APN 9 108826607 missense probably benign 0.04
IGL03162:Celsr3 APN 9 108842558 missense probably damaging 1.00
IGL03267:Celsr3 APN 9 108836525 splice site probably benign
F6893:Celsr3 UTSW 9 108835067 missense probably benign 0.00
R0110:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0243:Celsr3 UTSW 9 108843724 splice site probably benign
R0382:Celsr3 UTSW 9 108829218 missense probably damaging 1.00
R0482:Celsr3 UTSW 9 108829073 nonsense probably null
R0510:Celsr3 UTSW 9 108827005 missense possibly damaging 0.62
R0630:Celsr3 UTSW 9 108827692 missense probably damaging 0.98
R0656:Celsr3 UTSW 9 108834655 missense possibly damaging 0.89
R0764:Celsr3 UTSW 9 108827818 missense probably damaging 1.00
R0883:Celsr3 UTSW 9 108842633 missense probably damaging 1.00
R0924:Celsr3 UTSW 9 108846025 missense possibly damaging 0.78
R1015:Celsr3 UTSW 9 108833176 missense probably benign 0.17
R1321:Celsr3 UTSW 9 108835870 missense probably damaging 1.00
R1423:Celsr3 UTSW 9 108826905 missense probably benign 0.00
R1497:Celsr3 UTSW 9 108848865 missense probably benign 0.14
R1520:Celsr3 UTSW 9 108848658 missense probably damaging 1.00
R1534:Celsr3 UTSW 9 108848884 missense probably damaging 0.99
R1569:Celsr3 UTSW 9 108829068 missense probably damaging 1.00
R1753:Celsr3 UTSW 9 108831857 missense probably damaging 0.99
R1764:Celsr3 UTSW 9 108828958 missense probably damaging 1.00
R1801:Celsr3 UTSW 9 108834626 missense possibly damaging 0.88
R1838:Celsr3 UTSW 9 108829906 missense probably benign
R1839:Celsr3 UTSW 9 108829906 missense probably benign
R1874:Celsr3 UTSW 9 108835838 missense probably benign
R1875:Celsr3 UTSW 9 108835838 missense probably benign
R1953:Celsr3 UTSW 9 108843182 missense probably benign 0.19
R1960:Celsr3 UTSW 9 108845817 missense probably benign
R2113:Celsr3 UTSW 9 108838470 missense probably damaging 1.00
R2290:Celsr3 UTSW 9 108843224 missense probably damaging 1.00
R2369:Celsr3 UTSW 9 108842552 missense probably benign
R2373:Celsr3 UTSW 9 108842552 missense probably benign
R2374:Celsr3 UTSW 9 108842552 missense probably benign
R2375:Celsr3 UTSW 9 108842552 missense probably benign
R2844:Celsr3 UTSW 9 108829308 missense probably damaging 1.00
R2968:Celsr3 UTSW 9 108832191 missense probably damaging 1.00
R3103:Celsr3 UTSW 9 108837139 missense probably benign 0.31
R3159:Celsr3 UTSW 9 108827710 missense possibly damaging 0.94
R3791:Celsr3 UTSW 9 108842552 missense probably benign
R4194:Celsr3 UTSW 9 108843302 critical splice donor site probably null
R4329:Celsr3 UTSW 9 108846049 missense probably benign 0.00
R4365:Celsr3 UTSW 9 108829847 missense possibly damaging 0.47
R4419:Celsr3 UTSW 9 108843244 missense possibly damaging 0.84
R4484:Celsr3 UTSW 9 108846063 critical splice donor site probably null
R4582:Celsr3 UTSW 9 108845723 missense probably damaging 1.00
R4681:Celsr3 UTSW 9 108827754 missense possibly damaging 0.58
R4729:Celsr3 UTSW 9 108847652 missense probably benign 0.05
R4881:Celsr3 UTSW 9 108843941 missense probably damaging 1.00
R4893:Celsr3 UTSW 9 108849421 missense probably damaging 1.00
R5183:Celsr3 UTSW 9 108837560 missense probably damaging 0.99
R5207:Celsr3 UTSW 9 108832759 missense probably benign 0.01
R5290:Celsr3 UTSW 9 108843158 missense probably benign 0.01
R5327:Celsr3 UTSW 9 108842708 intron probably benign
R5345:Celsr3 UTSW 9 108832124 missense probably damaging 1.00
R5358:Celsr3 UTSW 9 108832025 missense possibly damaging 0.96
R5396:Celsr3 UTSW 9 108828582 missense probably damaging 1.00
R5414:Celsr3 UTSW 9 108840042 missense possibly damaging 0.88
R5452:Celsr3 UTSW 9 108844034 missense possibly damaging 0.68
R5467:Celsr3 UTSW 9 108828637 missense probably damaging 1.00
R5479:Celsr3 UTSW 9 108844544 critical splice donor site probably null
R5629:Celsr3 UTSW 9 108849067 missense probably benign 0.41
R5637:Celsr3 UTSW 9 108837133 missense probably damaging 1.00
R5652:Celsr3 UTSW 9 108838472 missense probably benign 0.03
R5739:Celsr3 UTSW 9 108827158 missense probably benign
R5785:Celsr3 UTSW 9 108827797 missense probably damaging 1.00
R5877:Celsr3 UTSW 9 108845727 missense probably damaging 0.98
R5961:Celsr3 UTSW 9 108831794 missense probably damaging 1.00
R6046:Celsr3 UTSW 9 108837151 missense probably benign 0.01
R6176:Celsr3 UTSW 9 108828355 missense probably damaging 1.00
R6291:Celsr3 UTSW 9 108828842 missense probably damaging 1.00
R6468:Celsr3 UTSW 9 108835790 missense probably benign 0.08
R6481:Celsr3 UTSW 9 108837084 missense possibly damaging 0.92
R6547:Celsr3 UTSW 9 108829128 missense probably damaging 1.00
R6763:Celsr3 UTSW 9 108827350 missense probably damaging 1.00
R6870:Celsr3 UTSW 9 108829191 missense probably benign 0.02
R6977:Celsr3 UTSW 9 108827715 missense probably benign
X0018:Celsr3 UTSW 9 108827778 missense possibly damaging 0.65
X0018:Celsr3 UTSW 9 108840412 missense probably benign 0.01
X0026:Celsr3 UTSW 9 108828930 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACAAATCCCTGCCTGCAATGGGAC -3'
(R):5'- ACGCACATTGGACTTGAGGCTG -3'

Sequencing Primer
(F):5'- CACGTCCTGGGCAGAAAG -3'
(R):5'- TCAGTACTAGCGCCGTTACAG -3'
Posted On2014-05-09