Incidental Mutation 'R1657:Mtif2'
ID186476
Institutional Source Beutler Lab
Gene Symbol Mtif2
Ensembl Gene ENSMUSG00000020459
Gene Namemitochondrial translational initiation factor 2
Synonyms2310038D14Rik, 2410112O06Rik, IF-2mt
MMRRC Submission 039693-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29526408-29545279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 29540721 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 475 (R475Q)
Ref Sequence ENSEMBL: ENSMUSP00000090926 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020749] [ENSMUST00000093239] [ENSMUST00000144321]
Predicted Effect probably benign
Transcript: ENSMUST00000020749
AA Change: R475Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020749
Gene: ENSMUSG00000020459
AA Change: R475Q

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093239
AA Change: R475Q

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000090926
Gene: ENSMUSG00000020459
AA Change: R475Q

DomainStartEndE-ValueType
Pfam:SRPRB 178 310 2.1e-6 PFAM
Pfam:GTP_EFTU 179 344 8.9e-34 PFAM
Pfam:MMR_HSR1 182 289 6.9e-10 PFAM
coiled coil region 449 484 N/A INTRINSIC
Pfam:IF-2 504 607 6.5e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129893
Predicted Effect probably benign
Transcript: ENSMUST00000132783
SMART Domains Protein: ENSMUSP00000121327
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
PDB:3IZY|P 47 247 8e-92 PDB
SCOP:d1g7sa1 163 244 2e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144321
SMART Domains Protein: ENSMUSP00000114299
Gene: ENSMUSG00000020459

DomainStartEndE-ValueType
Pfam:Arf 175 341 1.1e-5 PFAM
Pfam:SRPRB 178 310 1.5e-6 PFAM
Pfam:GTP_EFTU 178 344 3.8e-39 PFAM
Pfam:MMR_HSR1 182 289 1.1e-8 PFAM
Pfam:Miro 182 291 1.2e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] During the initiation of protein biosynthesis, initiation factor-2 (IF-2) promotes the binding of the initiator tRNA to the small subunit of the ribosome in a GTP-dependent manner. Prokaryotic IF-2 is a single polypeptide, while eukaryotic cytoplasmic IF-2 (eIF-2) is a trimeric protein. Bovine liver mitochondria contain IF-2(mt), an 85-kD monomeric protein that is equivalent to prokaryotic IF-2. The predicted 727-amino acid human protein contains a 29-amino acid presequence. Human IF-2(mt) shares 32 to 38% amino acid sequence identity with yeast IF-2(mt) and several prokaryotic IF-2s, with the greatest degree of conservation in the G domains of the proteins. [provided by RefSeq, Mar 2016]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
3632451O06Rik G C 14: 49,773,560 T230S probably damaging Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in Mtif2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Mtif2 APN 11 29538753 missense probably damaging 1.00
IGL01020:Mtif2 APN 11 29544973 missense possibly damaging 0.61
IGL01323:Mtif2 APN 11 29541447 missense probably damaging 0.98
IGL01360:Mtif2 APN 11 29530110 missense probably benign 0.00
IGL01744:Mtif2 APN 11 29544417 unclassified probably benign
IGL01757:Mtif2 APN 11 29541337 unclassified probably benign
IGL02247:Mtif2 APN 11 29540642 missense possibly damaging 0.65
IGL02642:Mtif2 APN 11 29544395 missense probably benign
IGL03093:Mtif2 APN 11 29530702 splice site probably benign
R0418:Mtif2 UTSW 11 29533401 splice site probably benign
R0554:Mtif2 UTSW 11 29533398 critical splice donor site probably null
R0577:Mtif2 UTSW 11 29540862 critical splice donor site probably null
R1159:Mtif2 UTSW 11 29540729 missense possibly damaging 0.95
R1168:Mtif2 UTSW 11 29536914 missense probably benign 0.11
R1344:Mtif2 UTSW 11 29545002 missense probably benign
R1418:Mtif2 UTSW 11 29545002 missense probably benign
R1482:Mtif2 UTSW 11 29536847 missense probably damaging 1.00
R1850:Mtif2 UTSW 11 29540683 missense probably benign 0.03
R3692:Mtif2 UTSW 11 29540718 missense probably benign 0.03
R4471:Mtif2 UTSW 11 29540053 splice site probably benign
R4730:Mtif2 UTSW 11 29540834 missense probably benign 0.00
R5248:Mtif2 UTSW 11 29536889 missense probably damaging 1.00
R5343:Mtif2 UTSW 11 29536964 missense probably damaging 1.00
R5989:Mtif2 UTSW 11 29530098 missense probably damaging 0.96
R6511:Mtif2 UTSW 11 29536949 missense possibly damaging 0.81
R7209:Mtif2 UTSW 11 29529996 missense probably benign 0.00
R7318:Mtif2 UTSW 11 29540115 missense probably benign 0.25
X0064:Mtif2 UTSW 11 29538760 missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- ATAGGCTGGAGAGACCTTCCTTCTGC -3'
(R):5'- GGCTTAGAGAGCAAGACTGCAACTC -3'

Sequencing Primer
(F):5'- TGAGGTATTCAAGCCTAATTCCC -3'
(R):5'- GAGCAAGACTGCAACTCTTCAC -3'
Posted On2014-05-09