Incidental Mutation 'R1657:3632451O06Rik'
ID186488
Institutional Source Beutler Lab
Gene Symbol 3632451O06Rik
Ensembl Gene ENSMUSG00000036242
Gene NameRIKEN cDNA 3632451O06 gene
Synonyms
MMRRC Submission 039693-MU
Accession Numbers

NCBI RefSeq: NM_026142.4; MGI:1914669

Is this an essential gene? Probably non essential (E-score: 0.103) question?
Stock #R1657 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location49675952-49783383 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 49773560 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 230 (T230S)
Ref Sequence ENSEMBL: ENSMUSP00000113609 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036972] [ENSMUST00000118129]
Predicted Effect probably benign
Transcript: ENSMUST00000036972
AA Change: T230S

PolyPhen 2 Score 0.253 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000036220
Gene: ENSMUSG00000036242
AA Change: T230S

DomainStartEndE-ValueType
Pfam:DUF4696 48 609 3.8e-224 PFAM
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 753 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118129
AA Change: T230S

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113609
Gene: ENSMUSG00000036242
AA Change: T230S

DomainStartEndE-ValueType
coiled coil region 603 644 N/A INTRINSIC
transmembrane domain 714 736 N/A INTRINSIC
low complexity region 741 754 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009B22Rik T C 11: 51,685,678 Q131R probably benign Het
Acaca T G 11: 84,264,084 D988E probably benign Het
Als2 A G 1: 59,180,601 V1185A probably damaging Het
Amdhd2 A G 17: 24,156,055 V391A probably damaging Het
Caprin1 A T 2: 103,769,506 V608E probably damaging Het
Celsr3 T A 9: 108,842,952 C2512* probably null Het
Cfl1 A T 19: 5,493,555 R187W probably damaging Het
Cgnl1 C T 9: 71,725,944 V42I probably damaging Het
Chd2 A G 7: 73,480,430 Y826H probably damaging Het
Col9a2 C A 4: 121,040,974 P28T unknown Het
Cyp3a44 G A 5: 145,779,743 P346S probably damaging Het
Dact2 A G 17: 14,197,990 V151A probably benign Het
Dhx29 T C 13: 112,952,843 I716T probably damaging Het
Esam T C 9: 37,537,621 S342P probably damaging Het
Fam189a2 C A 19: 23,975,635 C437F probably damaging Het
Fer1l4 A G 2: 156,035,598 V1053A possibly damaging Het
Grk3 A G 5: 112,966,982 F124S probably damaging Het
H2-DMa G A 17: 34,137,399 probably null Het
Hsd3b5 T A 3: 98,619,720 I137F possibly damaging Het
Itgav A T 2: 83,801,779 I902F probably benign Het
Itsn1 G T 16: 91,909,223 C179F probably damaging Het
Kcnh8 G A 17: 52,839,125 R347H probably damaging Het
Kif9 T C 9: 110,489,966 M166T possibly damaging Het
Kmt5c C T 7: 4,746,454 Q324* probably null Het
Lcn9 G A 2: 25,824,710 E154K probably benign Het
Mfge8 A T 7: 79,141,773 L227Q probably benign Het
Mroh2b A T 15: 4,931,043 R753* probably null Het
Mtif2 G A 11: 29,540,721 R475Q probably benign Het
Nln C T 13: 104,036,947 V584I possibly damaging Het
Nr2e3 T C 9: 59,948,767 E129G probably benign Het
Ocstamp T C 2: 165,397,516 D250G probably damaging Het
Olfr1065 A C 2: 86,445,218 L255V probably damaging Het
Olfr403 A T 11: 74,195,896 H131L probably damaging Het
Olfr503 T C 7: 108,545,377 I284T possibly damaging Het
Pld1 A T 3: 28,071,187 I417L probably benign Het
Polr1a A T 6: 71,941,535 K692N probably damaging Het
Qsox2 A T 2: 26,220,747 Y152* probably null Het
Rpap1 T C 2: 119,783,778 D46G possibly damaging Het
Rpe65 A G 3: 159,614,448 T246A probably damaging Het
Scn5a T C 9: 119,562,380 D82G probably damaging Het
Sema3d A G 5: 12,584,974 E669G possibly damaging Het
Serpinb6c T C 13: 33,880,226 N282S probably benign Het
Snap47 A T 11: 59,428,770 S181T probably benign Het
Snx9 A C 17: 5,918,436 T336P possibly damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Terb1 A T 8: 104,488,491 D284E possibly damaging Het
Tmem266 C T 9: 55,418,008 A153V probably damaging Het
Ttn T C 2: 76,742,804 E25915G possibly damaging Het
Tubal3 A G 13: 3,933,011 T264A possibly damaging Het
Vldlr G A 19: 27,245,670 R747Q probably benign Het
Zc3h8 G T 2: 128,929,957 probably benign Het
Zfp184 C T 13: 21,959,273 T383M probably damaging Het
Zfp455 T C 13: 67,198,639 F38S possibly damaging Het
Zfp746 A G 6: 48,082,174 V167A possibly damaging Het
Zfp985 T A 4: 147,584,110 N478K probably benign Het
Other mutations in 3632451O06Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:3632451O06Rik APN 14 49773003 missense probably damaging 1.00
IGL00981:3632451O06Rik APN 14 49772990 missense probably damaging 1.00
IGL01447:3632451O06Rik APN 14 49768466 missense probably damaging 0.99
IGL01645:3632451O06Rik APN 14 49773554 missense probably damaging 1.00
IGL02135:3632451O06Rik APN 14 49773929 missense probably damaging 0.99
IGL02154:3632451O06Rik APN 14 49772942 missense possibly damaging 0.58
IGL02163:3632451O06Rik APN 14 49774157 missense possibly damaging 0.61
IGL03234:3632451O06Rik APN 14 49768516 missense probably damaging 1.00
P0014:3632451O06Rik UTSW 14 49751659 missense probably damaging 1.00
R0165:3632451O06Rik UTSW 14 49773786 missense probably benign
R0240:3632451O06Rik UTSW 14 49768402 splice site probably benign
R0553:3632451O06Rik UTSW 14 49682686 missense probably damaging 0.99
R0616:3632451O06Rik UTSW 14 49773656 missense possibly damaging 0.74
R0635:3632451O06Rik UTSW 14 49773143 missense probably benign 0.00
R1423:3632451O06Rik UTSW 14 49751439 missense probably damaging 1.00
R1547:3632451O06Rik UTSW 14 49773496 missense probably benign 0.01
R1642:3632451O06Rik UTSW 14 49768410 splice site probably null
R1717:3632451O06Rik UTSW 14 49751664 missense probably damaging 0.99
R1875:3632451O06Rik UTSW 14 49682358 missense probably damaging 1.00
R1900:3632451O06Rik UTSW 14 49770583 missense probably damaging 1.00
R1916:3632451O06Rik UTSW 14 49768475 missense probably damaging 1.00
R1945:3632451O06Rik UTSW 14 49768483 missense probably damaging 1.00
R2102:3632451O06Rik UTSW 14 49774002 missense probably damaging 0.98
R2147:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R2149:3632451O06Rik UTSW 14 49751571 missense probably benign 0.31
R3921:3632451O06Rik UTSW 14 49774202 missense probably benign 0.13
R4063:3632451O06Rik UTSW 14 49773987 missense probably benign 0.02
R4373:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4374:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4377:3632451O06Rik UTSW 14 49770436 missense probably damaging 1.00
R4589:3632451O06Rik UTSW 14 49773582 missense probably damaging 1.00
R4940:3632451O06Rik UTSW 14 49773482 missense probably benign 0.15
R4986:3632451O06Rik UTSW 14 49751654 missense probably damaging 0.97
R5047:3632451O06Rik UTSW 14 49770438 missense probably damaging 1.00
R5104:3632451O06Rik UTSW 14 49773472 missense possibly damaging 0.77
R5682:3632451O06Rik UTSW 14 49751586 missense probably damaging 1.00
R6357:3632451O06Rik UTSW 14 49773312 missense probably benign 0.10
R6478:3632451O06Rik UTSW 14 49773332 missense possibly damaging 0.61
R6673:3632451O06Rik UTSW 14 49770592 missense probably benign 0.00
R7035:3632451O06Rik UTSW 14 49773050 missense possibly damaging 0.77
R7054:3632451O06Rik UTSW 14 49773698 missense probably damaging 1.00
X0026:3632451O06Rik UTSW 14 49682736 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTGTCATCCCACTCCTCATTGAAG -3'
(R):5'- CCCCAGCCTGCTTGAAAGAATGTC -3'

Sequencing Primer
(F):5'- AGCTGTGCTGACACTCACTG -3'
(R):5'- GAATGTCTTCTGAGCACAGC -3'
Posted On2014-05-09