Incidental Mutation 'R1658:Ugp2'
ID186542
Institutional Source Beutler Lab
Gene Symbol Ugp2
Ensembl Gene ENSMUSG00000001891
Gene NameUDP-glucose pyrophosphorylase 2
Synonyms
MMRRC Submission 039694-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1658 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location21321138-21371201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21333774 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 98 (P98S)
Ref Sequence ENSEMBL: ENSMUSP00000099939 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060895] [ENSMUST00000102875]
Predicted Effect probably benign
Transcript: ENSMUST00000060895
AA Change: P87S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000056324
Gene: ENSMUSG00000001891
AA Change: P87S

DomainStartEndE-ValueType
low complexity region 14 29 N/A INTRINSIC
Pfam:UDPGP 43 462 2.1e-197 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102875
AA Change: P98S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099939
Gene: ENSMUSG00000001891
AA Change: P98S

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
Pfam:UDPGP 55 473 3.5e-201 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133343
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The enzyme encoded by this gene is an important intermediary in mammalian carbohydrate interconversions. It transfers a glucose moiety from glucose-1-phosphate to MgUTP and forms UDP-glucose and MgPPi. In liver and muscle tissue, UDP-glucose is a direct precursor of glycogen; in lactating mammary gland it is converted to UDP-galactose which is then converted to lactose. The eukaryotic enzyme has no significant sequence similarity to the prokaryotic enzyme. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrd1 T G 5: 129,178,100 S604A probably benign Het
Apbb1 G A 7: 105,574,084 P107S probably damaging Het
Baz2a T A 10: 128,124,383 M1489K probably benign Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdca2 A G 14: 67,677,699 S704P possibly damaging Het
Chfr T C 5: 110,153,169 I312T probably damaging Het
Csmd1 A G 8: 16,081,725 V1662A possibly damaging Het
Dgkd T A 1: 87,926,268 L611Q probably damaging Het
Dicer1 A G 12: 104,700,414 V1376A probably benign Het
Elp2 C T 18: 24,617,413 T269M probably benign Het
Ephb6 T A 6: 41,614,245 V112E probably damaging Het
Fbxo11 A T 17: 88,012,658 Y209N probably benign Het
Frem1 C T 4: 83,001,808 R437Q probably damaging Het
G6pc2 A T 2: 69,227,069 K353M probably damaging Het
Gabbr1 A G 17: 37,047,507 T46A probably damaging Het
Gbp9 T A 5: 105,094,468 Q135L probably damaging Het
Gstp1 A T 19: 4,037,375 M20K probably damaging Het
Heatr6 A G 11: 83,758,367 R183G probably damaging Het
Ints11 A G 4: 155,887,728 K397E probably damaging Het
Intu A G 3: 40,692,781 T695A probably benign Het
Kif21b T C 1: 136,171,285 V1437A probably damaging Het
Klhl24 T A 16: 20,107,092 Y123* probably null Het
Lipm C T 19: 34,116,447 L255F probably benign Het
Max A T 12: 76,938,581 M121K probably benign Het
Mga A T 2: 119,941,689 I1677L possibly damaging Het
Msantd1 C A 5: 34,921,561 L147M probably damaging Het
Msantd1 T A 5: 34,921,562 L147Q probably benign Het
Mylk4 T C 13: 32,712,789 D363G possibly damaging Het
Naaa T C 5: 92,272,441 probably null Het
Ninl A G 2: 150,964,159 Y381H probably damaging Het
Nwd2 A G 5: 63,807,246 N1391S probably damaging Het
Olfr1537 C T 9: 39,237,959 C155Y probably benign Het
Olfr421-ps1 G A 1: 174,152,223 A236T probably damaging Het
Phip A G 9: 82,871,498 V1731A probably benign Het
Plxnb1 T A 9: 109,102,871 C488* probably null Het
Rgs7 T C 1: 175,079,554 I374V probably benign Het
Rin2 A T 2: 145,876,456 M574L probably benign Het
Rps18 A T 17: 33,952,418 D92E probably benign Het
Scrn1 T A 6: 54,520,806 I267L probably benign Het
Stard9 T C 2: 120,701,542 V67A probably benign Het
Syne1 T G 10: 5,367,616 M493L probably benign Het
Tbc1d2 G A 4: 46,614,207 R625C probably damaging Het
Tcerg1l A G 7: 138,394,180 S200P probably damaging Het
Tet3 A T 6: 83,369,057 V1331E probably benign Het
Ticrr A T 7: 79,695,549 I1721F possibly damaging Het
Tjp2 T C 19: 24,112,947 D577G probably damaging Het
Tmem2 T C 19: 21,801,879 V351A probably damaging Het
Tmem38b A G 4: 53,840,713 M43V probably benign Het
Trabd T A 15: 89,085,866 probably null Het
Trpv5 C A 6: 41,674,282 D277Y probably damaging Het
Tubb1 A C 2: 174,456,623 D67A probably damaging Het
Ubxn7 A G 16: 32,381,236 probably null Het
Vmn2r66 G T 7: 85,007,747 P150Q probably benign Het
Zbtb11 A T 16: 55,974,225 H55L possibly damaging Het
Other mutations in Ugp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Ugp2 APN 11 21354345 missense probably benign
IGL01161:Ugp2 APN 11 21323273 missense possibly damaging 0.82
IGL01759:Ugp2 APN 11 21353447 missense probably benign 0.01
IGL03037:Ugp2 APN 11 21332540 nonsense probably null
IGL03092:Ugp2 APN 11 21329722 splice site probably benign
bittern UTSW 11 21322051 unclassified probably null
PIT4377001:Ugp2 UTSW 11 21370203 start codon destroyed probably null 0.33
R1538:Ugp2 UTSW 11 21333791 missense possibly damaging 0.88
R1771:Ugp2 UTSW 11 21329915 missense probably damaging 1.00
R1874:Ugp2 UTSW 11 21329048 missense probably damaging 1.00
R1970:Ugp2 UTSW 11 21328942 missense probably damaging 0.99
R2143:Ugp2 UTSW 11 21328949 missense probably benign
R2431:Ugp2 UTSW 11 21329025 missense probably damaging 1.00
R3888:Ugp2 UTSW 11 21353366 missense probably benign 0.01
R4352:Ugp2 UTSW 11 21329026 missense probably damaging 0.99
R5018:Ugp2 UTSW 11 21331052 missense probably damaging 1.00
R6125:Ugp2 UTSW 11 21329815 missense probably damaging 0.97
R6388:Ugp2 UTSW 11 21322051 unclassified probably null
R6466:Ugp2 UTSW 11 21328883 missense probably benign 0.01
R6626:Ugp2 UTSW 11 21331028 missense probably damaging 1.00
R7219:Ugp2 UTSW 11 21323271 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACGAGGATGAGAACACCCTCTAC -3'
(R):5'- GCTACAACTCTGCAAGGGAAGCTG -3'

Sequencing Primer
(F):5'- AGAATACGTCCTTACAGTGTCC -3'
(R):5'- AAGCTGCCTGTGTGGAC -3'
Posted On2014-05-09