Incidental Mutation 'R1659:Rbfox3'
ID186610
Institutional Source Beutler Lab
Gene Symbol Rbfox3
Ensembl Gene ENSMUSG00000025576
Gene NameRNA binding protein, fox-1 homolog (C. elegans) 3
SynonymsD11Bwg0517e, NeuN, Neuna60, Hrnbp3
MMRRC Submission 039695-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.213) question?
Stock #R1659 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location118489762-118911597 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 118494155 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 359 (T359A)
Ref Sequence ENSEMBL: ENSMUSP00000113636 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017576] [ENSMUST00000069343] [ENSMUST00000103023] [ENSMUST00000106278] [ENSMUST00000117731] [ENSMUST00000120061] [ENSMUST00000135383] [ENSMUST00000139917] [ENSMUST00000154746]
Predicted Effect probably damaging
Transcript: ENSMUST00000017576
AA Change: T359A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000017576
Gene: ENSMUSG00000025576
AA Change: T359A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 208 269 1e-22 PFAM
Pfam:Fox-1_C 279 345 3.9e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000069343
AA Change: T328A

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000069598
Gene: ENSMUSG00000025576
AA Change: T328A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 165 8.3e-2 SMART
Pfam:Fox-1_C 176 229 4.1e-15 PFAM
Pfam:Fox-1_C 226 314 4.8e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103023
AA Change: T312A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000099312
Gene: ENSMUSG00000025576
AA Change: T312A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106278
AA Change: T312A

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000101885
Gene: ENSMUSG00000025576
AA Change: T312A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 4.2e-43 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117731
AA Change: T359A

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113636
Gene: ENSMUSG00000025576
AA Change: T359A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 260 3.5e-15 PFAM
Pfam:Fox-1_C 257 345 4.3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120061
AA Change: T312A

PolyPhen 2 Score 0.073 (Sensitivity: 0.93; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113987
Gene: ENSMUSG00000025576
AA Change: T312A

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 24 29 N/A INTRINSIC
RRM 100 171 1.01e-24 SMART
Pfam:Fox-1_C 207 298 6.1e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135383
SMART Domains Protein: ENSMUSP00000117538
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 102 120 N/A INTRINSIC
Pfam:Glyco_hydro_85 127 404 2.6e-101 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139917
SMART Domains Protein: ENSMUSP00000129698
Gene: ENSMUSG00000033857

DomainStartEndE-ValueType
low complexity region 30 40 N/A INTRINSIC
low complexity region 79 92 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154746
SMART Domains Protein: ENSMUSP00000118332
Gene: ENSMUSG00000025576

DomainStartEndE-ValueType
RRM 1 54 8.6e-5 SMART
Pfam:Fox-1_C 90 142 5.5e-16 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.6%
  • 20x: 93.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit reduced brain weight, increased susceptibility kainic acid-induced seizures, decreased anxiety-related behaviors, and deficits in synaptic transmission and plasticity in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap9 T A 5: 4,064,633 L87Q probably damaging Het
Atp13a5 T G 16: 29,293,433 D630A probably benign Het
Brd7 G T 8: 88,333,792 P568T probably damaging Het
Ccdc141 A G 2: 77,054,683 L538P probably benign Het
Cd177 G T 7: 24,746,137 T627K probably damaging Het
Cd84 A G 1: 171,872,750 T145A possibly damaging Het
Cdhr2 T A 13: 54,719,761 I468N probably damaging Het
Cdk14 T C 5: 4,949,571 T338A probably benign Het
Celsr2 G A 3: 108,414,095 T467I probably benign Het
Chrd A G 16: 20,735,831 E380G probably damaging Het
Cnnm4 C A 1: 36,472,165 T158N probably benign Het
Ddx51 T A 5: 110,655,120 I254N probably damaging Het
Deptor G A 15: 55,218,274 probably null Het
Dnah11 T A 12: 118,120,724 H1215L possibly damaging Het
Dock1 A G 7: 134,789,243 Y744C probably damaging Het
Dok7 C T 5: 35,079,139 T257I possibly damaging Het
Eif4g1 T C 16: 20,681,061 Y591H probably damaging Het
Fat3 T C 9: 15,997,183 T2508A possibly damaging Het
Gm266 A G 12: 111,485,289 V161A probably damaging Het
Golgb1 A G 16: 36,887,617 I107V probably benign Het
Gpnmb T C 6: 49,047,852 F273L probably damaging Het
Hcn1 A T 13: 117,976,074 Q858L probably damaging Het
Hcrtr1 G T 4: 130,135,336 Y224* probably null Het
Hepacam A G 9: 37,380,658 D94G probably benign Het
Herc2 T A 7: 56,135,105 H1432Q probably benign Het
Il20 T A 1: 130,908,349 probably null Het
Itga10 A G 3: 96,662,977 T1150A probably damaging Het
Itgax C T 7: 128,130,891 T73I probably benign Het
Kdm6b T A 11: 69,407,588 Q98L possibly damaging Het
Lrrc7 A G 3: 158,161,408 W899R probably damaging Het
Meikin C A 11: 54,390,566 S154* probably null Het
Mrgprg A T 7: 143,764,551 S275T possibly damaging Het
Mstn C T 1: 53,064,077 R191* probably null Het
Neu3 A G 7: 99,813,433 I361T probably damaging Het
Nrxn3 A G 12: 90,332,391 D425G probably damaging Het
Nup205 T A 6: 35,234,788 M1688K probably benign Het
Olfr412 A T 11: 74,364,933 Q88L probably benign Het
Olfr665 A G 7: 104,881,180 M158V probably benign Het
Omg C T 11: 79,502,900 C44Y possibly damaging Het
Pcdh8 T C 14: 79,768,134 D938G probably damaging Het
Pp2d1 T C 17: 53,515,378 D220G possibly damaging Het
Prune2 C T 19: 17,120,651 T1173I possibly damaging Het
Rhpn2 A G 7: 35,377,041 Y339C probably damaging Het
Rpl7a-ps3 A G 15: 36,308,163 noncoding transcript Het
Sars T C 3: 108,429,416 E217G probably damaging Het
Sec61a2 A G 2: 5,886,534 F62S possibly damaging Het
Slc12a7 T A 13: 73,790,671 I189N probably damaging Het
Slc5a10 G A 11: 61,676,244 A375V possibly damaging Het
Srfbp1 C T 18: 52,488,895 H343Y possibly damaging Het
Tbck T G 3: 132,734,355 I486M probably damaging Het
Thra G A 11: 98,756,979 A60T probably damaging Het
Thsd7a T A 6: 12,504,064 T364S possibly damaging Het
Ttc16 C T 2: 32,762,535 D761N probably benign Het
Vwa7 T C 17: 35,019,071 L216P probably benign Het
Ydjc T C 16: 17,147,839 V156A possibly damaging Het
Other mutations in Rbfox3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01352:Rbfox3 APN 11 118505613 splice site probably benign
IGL01622:Rbfox3 APN 11 118505614 splice site probably benign
IGL01623:Rbfox3 APN 11 118505614 splice site probably benign
IGL01716:Rbfox3 APN 11 118513289 missense possibly damaging 0.89
IGL01772:Rbfox3 APN 11 118496971 missense probably damaging 0.98
IGL03162:Rbfox3 APN 11 118496431 missense probably benign 0.06
PIT4431001:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R0267:Rbfox3 UTSW 11 118495240 missense probably benign 0.00
R1681:Rbfox3 UTSW 11 118505669 missense probably damaging 1.00
R1698:Rbfox3 UTSW 11 118495221 missense probably damaging 1.00
R1731:Rbfox3 UTSW 11 118496936 critical splice donor site probably null
R2134:Rbfox3 UTSW 11 118497016 missense probably damaging 1.00
R2249:Rbfox3 UTSW 11 118503738 missense probably damaging 0.99
R3051:Rbfox3 UTSW 11 118502888 missense probably damaging 1.00
R3404:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3405:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R3406:Rbfox3 UTSW 11 118496457 missense possibly damaging 0.93
R5276:Rbfox3 UTSW 11 118496352 missense probably damaging 1.00
R7243:Rbfox3 UTSW 11 118513274 missense probably damaging 1.00
X0013:Rbfox3 UTSW 11 118497041 missense probably benign 0.29
Predicted Primers PCR Primer
(F):5'- CACTTCACCAGGAGGAATGGGTTAC -3'
(R):5'- CGTGTCACCAAGCAGAACACATTG -3'

Sequencing Primer
(F):5'- GGGTTACATCTGCCCAAACTG -3'
(R):5'- CTCCTAACGAAGGGGTAGTCTG -3'
Posted On2014-05-09