Incidental Mutation 'R1660:Tuba4a'
ID186631
Institutional Source Beutler Lab
Gene Symbol Tuba4a
Ensembl Gene ENSMUSG00000026202
Gene Nametubulin, alpha 4A
SynonymsTuba4, M[a]4
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.526) question?
Stock #R1660 (G1)
Quality Score162
Status Not validated
Chromosome1
Chromosomal Location75214228-75219865 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 75215903 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 356 (N356D)
Ref Sequence ENSEMBL: ENSMUSP00000140657 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027401] [ENSMUST00000123825] [ENSMUST00000144355] [ENSMUST00000179573] [ENSMUST00000180101] [ENSMUST00000186213] [ENSMUST00000186758] [ENSMUST00000188460] [ENSMUST00000188593] [ENSMUST00000189131] [ENSMUST00000189698] [ENSMUST00000190717] [ENSMUST00000191108]
Predicted Effect probably benign
Transcript: ENSMUST00000027401
SMART Domains Protein: ENSMUSP00000027401
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 290 3.3e-47 PFAM
Pfam:Pkinase_Tyr 21 290 3e-28 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000079464
AA Change: N384D
SMART Domains Protein: ENSMUSP00000078429
Gene: ENSMUSG00000026202
AA Change: N384D

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123825
SMART Domains Protein: ENSMUSP00000122688
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126328
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131738
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142052
Predicted Effect probably benign
Transcript: ENSMUST00000144355
SMART Domains Protein: ENSMUSP00000115964
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 122 9.1e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156012
Predicted Effect probably benign
Transcript: ENSMUST00000179573
Predicted Effect probably benign
Transcript: ENSMUST00000180101
Predicted Effect probably benign
Transcript: ENSMUST00000186213
AA Change: N356D

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000140657
Gene: ENSMUSG00000026202
AA Change: N356D

DomainStartEndE-ValueType
Tubulin 49 246 4.34e-79 SMART
Tubulin_C 248 393 7.88e-59 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186492
Predicted Effect probably benign
Transcript: ENSMUST00000186758
SMART Domains Protein: ENSMUSP00000140552
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 100 1.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186971
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187103
Predicted Effect probably benign
Transcript: ENSMUST00000188460
SMART Domains Protein: ENSMUSP00000139998
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 172 1e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188593
SMART Domains Protein: ENSMUSP00000140881
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 2 75 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189131
SMART Domains Protein: ENSMUSP00000140970
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 81 3.6e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189242
Predicted Effect probably benign
Transcript: ENSMUST00000189698
SMART Domains Protein: ENSMUSP00000140329
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
S_TKc 20 203 1.1e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190717
SMART Domains Protein: ENSMUSP00000141097
Gene: ENSMUSG00000026202

DomainStartEndE-ValueType
Pfam:Tubulin 1 89 1.4e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000191108
SMART Domains Protein: ENSMUSP00000139846
Gene: ENSMUSG00000026201

DomainStartEndE-ValueType
Pfam:Pkinase 20 186 8.6e-29 PFAM
Pfam:Pkinase_Tyr 21 184 2.1e-14 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Microtubules of the eukaryotic cytoskeleton perform essential and diverse functions and are composed of a heterodimer of alpha and beta tubulin. The genes encoding these microtubule constituents are part of the tubulin superfamily, which is composed of six distinct families. Genes from the alpha, beta and gamma tubulin families are found in all eukaryotes. The alpha and beta tubulins represent the major components of microtubules, while gamma tubulin plays a critical role in the nucleation of microtubule assembly. There are multiple alpha and beta tubulin genes and they are highly conserved among and between species. This gene encodes an alpha tubulin that is a highly conserved homolog of a rat testis-specific alpha tubulin. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Tuba4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01346:Tuba4a APN 1 75217277 missense probably damaging 1.00
andropov UTSW 1 75217394 missense probably damaging 1.00
R0453:Tuba4a UTSW 1 75215858 missense probably damaging 1.00
R0573:Tuba4a UTSW 1 75216373 missense probably benign 0.01
R1488:Tuba4a UTSW 1 75216401 missense probably benign 0.08
R1836:Tuba4a UTSW 1 75216110 missense probably benign 0.20
R2012:Tuba4a UTSW 1 75216339 nonsense probably null
R2437:Tuba4a UTSW 1 75217425 missense possibly damaging 0.47
R4180:Tuba4a UTSW 1 75215782 missense probably benign 0.33
R5505:Tuba4a UTSW 1 75216416 missense probably damaging 1.00
R6137:Tuba4a UTSW 1 75216055 missense probably damaging 1.00
R6189:Tuba4a UTSW 1 75216874 missense probably benign 0.34
R6566:Tuba4a UTSW 1 75217286 missense probably damaging 1.00
R6837:Tuba4a UTSW 1 75217394 missense probably damaging 1.00
R6883:Tuba4a UTSW 1 75217422 missense probably damaging 1.00
R7213:Tuba4a UTSW 1 75215697 missense possibly damaging 0.86
Predicted Primers PCR Primer
(F):5'- ACAGTGAACAGGCTCCAAGTAGCG -3'
(R):5'- CCAGATGGTGAAATGTGACCCTCG -3'

Sequencing Primer
(F):5'- CTCATAGGAGTCGATGCCTAC -3'
(R):5'- GGCACGGCAAGTACATGG -3'
Posted On2014-05-09