Incidental Mutation 'R1660:Ncstn'
ID186635
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Namenicastrin
SynonymsNct, nicastrin, D1Dau13e, 9430068N19Rik
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172066013-172082795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172066772 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 677 (S677C)
Ref Sequence ENSEMBL: ENSMUSP00000003550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003550
AA Change: S677C

PolyPhen 2 Score 0.783 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: S677C

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135928
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 172074401 missense probably benign 0.02
IGL02030:Ncstn APN 1 172072457 splice site probably benign
IGL02470:Ncstn APN 1 172082599 critical splice donor site probably null
IGL02498:Ncstn APN 1 172068592 missense probably benign
pig UTSW 1 172071525 missense probably damaging 1.00
truffle UTSW 1 172070009 missense probably damaging 1.00
R0048:Ncstn UTSW 1 172069961 splice site probably benign
R0480:Ncstn UTSW 1 172082592 splice site probably benign
R0648:Ncstn UTSW 1 172067887 missense probably benign 0.01
R0792:Ncstn UTSW 1 172071505 missense possibly damaging 0.95
R1330:Ncstn UTSW 1 172071525 missense probably damaging 1.00
R1524:Ncstn UTSW 1 172072149 missense possibly damaging 0.58
R1828:Ncstn UTSW 1 172071471 frame shift probably null
R1892:Ncstn UTSW 1 172071471 frame shift probably null
R1907:Ncstn UTSW 1 172072143 missense probably damaging 0.97
R3722:Ncstn UTSW 1 172067895 missense possibly damaging 0.50
R3876:Ncstn UTSW 1 172070073 missense probably benign 0.02
R3946:Ncstn UTSW 1 172067494 missense probably benign 0.00
R3969:Ncstn UTSW 1 172070009 missense probably damaging 1.00
R4108:Ncstn UTSW 1 172072544 missense probably damaging 1.00
R4597:Ncstn UTSW 1 172068256 nonsense probably null
R4998:Ncstn UTSW 1 172071520 missense possibly damaging 0.81
R5037:Ncstn UTSW 1 172068626 missense probably damaging 1.00
R5150:Ncstn UTSW 1 172067584 intron probably benign
R5406:Ncstn UTSW 1 172072164 missense probably benign 0.00
R5444:Ncstn UTSW 1 172072839 missense possibly damaging 0.92
R5605:Ncstn UTSW 1 172081150 intron probably benign
R6675:Ncstn UTSW 1 172071528 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTGTCAATCCCCGTCTAAGCAG -3'
(R):5'- AGCAGAACCAGTGCAGTGTGTG -3'

Sequencing Primer
(F):5'- CAGTCCAGTGACAAATTAGTGG -3'
(R):5'- GAGCCCCTGTTATAAGTAAGTCAC -3'
Posted On2014-05-09