Incidental Mutation 'R1660:Nbn'
ID186648
Institutional Source Beutler Lab
Gene Symbol Nbn
Ensembl Gene ENSMUSG00000028224
Gene Namenibrin
SynonymsNbs1
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location15957925-15992589 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 15971771 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 301 (G301D)
Ref Sequence ENSEMBL: ENSMUSP00000029879 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029879] [ENSMUST00000149069]
Predicted Effect probably benign
Transcript: ENSMUST00000029879
AA Change: G301D

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000029879
Gene: ENSMUSG00000028224
AA Change: G301D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
Pfam:NIBRIN_BRCT_II 216 325 2.2e-34 PFAM
low complexity region 557 565 N/A INTRINSIC
Nbs1_C 680 744 2.14e-34 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118701
Predicted Effect probably benign
Transcript: ENSMUST00000149069
AA Change: G301D

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000120829
Gene: ENSMUSG00000028224
AA Change: G301D

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
FHA 23 83 2.27e-4 SMART
BRCT 103 184 6.37e0 SMART
PDB:2K2W|A 217 326 3e-32 PDB
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Nijmegen breakage syndrome, an autosomal recessive chromosomal instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition. The encoded protein is a member of the MRE11/RAD50 double-strand break repair complex which consists of 5 proteins. This gene product is thought to be involved in DNA double-strand break repair and DNA damage-induced checkpoint activation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutations exhibit phenotypes ranging from impaired extraembryonic tissue growth and early embryonic death to growth retardation, lymphoid defects, lymphoma susceptibility, and failure of oogenesis. Null heterozygotes are cancer prone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Nbn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00833:Nbn APN 4 15964320 missense probably benign 0.01
IGL00921:Nbn APN 4 15963833 missense possibly damaging 0.85
IGL01621:Nbn APN 4 15965221 missense probably benign 0.45
IGL02372:Nbn APN 4 15986613 missense probably benign 0.00
IGL03392:Nbn APN 4 15962362 missense probably damaging 1.00
R0238:Nbn UTSW 4 15986672 splice site probably benign
R0244:Nbn UTSW 4 15979353 missense probably benign 0.00
R0432:Nbn UTSW 4 15983951 unclassified probably benign
R0946:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1076:Nbn UTSW 4 15970719 critical splice acceptor site probably null
R1563:Nbn UTSW 4 15981668 missense possibly damaging 0.77
R1579:Nbn UTSW 4 15964289 missense probably damaging 0.99
R1663:Nbn UTSW 4 15970903 missense probably benign 0.13
R2005:Nbn UTSW 4 15979351 missense probably benign 0.01
R2010:Nbn UTSW 4 15969393 missense probably damaging 1.00
R2077:Nbn UTSW 4 15979389 missense probably damaging 1.00
R2228:Nbn UTSW 4 15970904 missense probably benign 0.01
R2229:Nbn UTSW 4 15970904 missense probably benign 0.01
R2356:Nbn UTSW 4 15970863 missense probably damaging 0.96
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R2869:Nbn UTSW 4 15963810 missense probably damaging 1.00
R3508:Nbn UTSW 4 15962387 missense probably damaging 1.00
R3745:Nbn UTSW 4 15976163 missense possibly damaging 0.67
R3753:Nbn UTSW 4 15964269 missense probably damaging 0.98
R4756:Nbn UTSW 4 15981470 missense probably benign 0.06
R5042:Nbn UTSW 4 15981446 missense probably benign 0.10
R5177:Nbn UTSW 4 15965132 critical splice acceptor site probably null
R5229:Nbn UTSW 4 15963893 missense probably damaging 0.98
R5368:Nbn UTSW 4 15969391 missense probably damaging 1.00
R5431:Nbn UTSW 4 15986593 missense probably benign
R6025:Nbn UTSW 4 15981347 missense probably damaging 0.97
R6375:Nbn UTSW 4 15979327 missense probably benign
R6543:Nbn UTSW 4 15986605 missense probably benign 0.39
R6655:Nbn UTSW 4 15981696 missense probably damaging 0.98
R6965:Nbn UTSW 4 15970863 missense probably benign 0.25
R7090:Nbn UTSW 4 15981350 missense probably benign 0.06
R7241:Nbn UTSW 4 15991190 missense probably benign 0.00
R7267:Nbn UTSW 4 15979320 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CACGCACTGCTAGTTTGGGAAAATG -3'
(R):5'- GCAGCACACAGTATCATGGCAGAAC -3'

Sequencing Primer
(F):5'- ttgcgacagaactggtctc -3'
(R):5'- gcacaacagtaacgtacataaataag -3'
Posted On2014-05-09