Incidental Mutation 'R1660:Grik2'
ID186677
Institutional Source Beutler Lab
Gene Symbol Grik2
Ensembl Gene ENSMUSG00000056073
Gene Nameglutamate receptor, ionotropic, kainate 2 (beta 2)
SynonymsGlurbeta2, Glur-6, Glur6
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location49094833-49788766 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 49244343 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Stop codon at position 56 (G56*)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079751] [ENSMUST00000105484] [ENSMUST00000218441] [ENSMUST00000218598] [ENSMUST00000218823]
Predicted Effect probably null
Transcript: ENSMUST00000079751
AA Change: G617*
SMART Domains Protein: ENSMUSP00000078687
Gene: ENSMUSG00000056073
AA Change: G617*

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105484
AA Change: G617*
SMART Domains Protein: ENSMUSP00000101124
Gene: ENSMUSG00000056073
AA Change: G617*

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105485
AA Change: G617*
SMART Domains Protein: ENSMUSP00000101125
Gene: ENSMUSG00000056073
AA Change: G617*

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 1.8e-11 PFAM
Pfam:ANF_receptor 52 395 8.3e-75 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 2e-12 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000105486
AA Change: G617*
SMART Domains Protein: ENSMUSP00000101126
Gene: ENSMUSG00000056073
AA Change: G617*

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 44 386 3.8e-11 PFAM
Pfam:ANF_receptor 52 395 1.5e-74 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 6e-13 BLAST
low complexity region 875 891 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105487
AA Change: G617*
SMART Domains Protein: ENSMUSP00000101127
Gene: ENSMUSG00000056073
AA Change: G617*

DomainStartEndE-ValueType
Pfam:Peripla_BP_6 46 386 5e-11 PFAM
Pfam:ANF_receptor 52 395 9.7e-80 PFAM
PBPe 432 801 5.6e-131 SMART
Lig_chan-Glu_bd 442 507 3.81e-34 SMART
Blast:PBPe 809 855 1e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217673
Predicted Effect probably null
Transcript: ENSMUST00000218441
AA Change: G617*
Predicted Effect probably null
Transcript: ENSMUST00000218598
AA Change: G617*
Predicted Effect probably null
Transcript: ENSMUST00000218823
AA Change: G617*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219051
Predicted Effect probably null
Transcript: ENSMUST00000219509
AA Change: G56*
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Glutamate receptors are the predominant excitatory neurotransmitter receptors in the mammalian brain and are activated in a variety of normal neurophysiologic processes. This gene product belongs to the kainate family of glutamate receptors, which are composed of four subunits and function as ligand-activated ion channels. The subunit encoded by this gene is subject to RNA editing at multiple sites within the first and second transmembrane domains, which is thought to alter the structure and function of the receptor complex. Alternatively spliced transcript variants encoding different isoforms have also been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit hippocampal neurons with reduced sensitivity to kainate and reduced susceptibility to the seizure-inducing effects of kainate administration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Skp2 A C 15: 9,125,114 V126G probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Grik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Grik2 APN 10 49355928 missense possibly damaging 0.95
IGL00979:Grik2 APN 10 49355938 missense probably damaging 1.00
IGL01012:Grik2 APN 10 49272956 missense probably damaging 1.00
IGL01302:Grik2 APN 10 49244330 missense probably damaging 0.99
IGL01657:Grik2 APN 10 49527986 critical splice donor site probably null
IGL02162:Grik2 APN 10 49422575 missense possibly damaging 0.77
IGL02317:Grik2 APN 10 49422615 missense probably benign 0.16
IGL02512:Grik2 APN 10 49355912 missense probably benign 0.00
IGL02650:Grik2 APN 10 49101235 missense probably benign 0.03
IGL03283:Grik2 APN 10 49578269 missense probably benign 0.00
R0325:Grik2 UTSW 10 49240725 missense probably damaging 1.00
R0492:Grik2 UTSW 10 49101164 missense probably damaging 0.99
R0601:Grik2 UTSW 10 49422597 missense probably damaging 1.00
R0844:Grik2 UTSW 10 49101115 missense possibly damaging 0.81
R1333:Grik2 UTSW 10 49527991 missense probably damaging 0.98
R1499:Grik2 UTSW 10 49132775 missense probably damaging 1.00
R1721:Grik2 UTSW 10 49523746 missense possibly damaging 0.93
R1966:Grik2 UTSW 10 49355909 missense probably damaging 1.00
R1974:Grik2 UTSW 10 49132827 missense possibly damaging 0.85
R2246:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R3103:Grik2 UTSW 10 49240772 missense probably damaging 1.00
R3974:Grik2 UTSW 10 49422654 missense probably damaging 1.00
R4592:Grik2 UTSW 10 49422615 missense possibly damaging 0.48
R4658:Grik2 UTSW 10 49523792 missense possibly damaging 0.71
R4748:Grik2 UTSW 10 49535341 missense possibly damaging 0.87
R4935:Grik2 UTSW 10 49240730 missense probably damaging 1.00
R4977:Grik2 UTSW 10 49132745 missense probably damaging 1.00
R5103:Grik2 UTSW 10 49496109 missense probably benign 0.33
R5330:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5331:Grik2 UTSW 10 49132771 missense probably damaging 1.00
R5736:Grik2 UTSW 10 49404410 missense probably damaging 0.96
R5740:Grik2 UTSW 10 49113477 missense probably damaging 0.99
R5747:Grik2 UTSW 10 49523774 missense probably benign
R6015:Grik2 UTSW 10 49523863 splice site probably null
R6311:Grik2 UTSW 10 49578138 missense probably damaging 0.98
R6474:Grik2 UTSW 10 49132680 missense probably benign
R6504:Grik2 UTSW 10 49356102 missense probably damaging 1.00
R6591:Grik2 UTSW 10 49272925 nonsense probably null
R6691:Grik2 UTSW 10 49272925 nonsense probably null
R6776:Grik2 UTSW 10 49355989 missense probably damaging 1.00
R7015:Grik2 UTSW 10 49535436 missense probably damaging 1.00
R7094:Grik2 UTSW 10 49355916 missense possibly damaging 0.75
R7153:Grik2 UTSW 10 49535367 missense probably benign 0.00
X0062:Grik2 UTSW 10 49272920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCGAGCTGTTTTCTCAGAATCTCTCT -3'
(R):5'- CCTGGTTTTGTGCCACAGTTGAGT -3'

Sequencing Primer
(F):5'- GTTTTCTCAGAATCTCTCTCAAATGG -3'
(R):5'- CACACTGTTGTCAGACTTATGAAATC -3'
Posted On2014-05-09