Incidental Mutation 'R1660:Skp2'
ID186696
Institutional Source Beutler Lab
Gene Symbol Skp2
Ensembl Gene ENSMUSG00000054115
Gene NameS-phase kinase-associated protein 2 (p45)
SynonymsFBXL1
MMRRC Submission 039696-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1660 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location9111985-9155425 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 9125114 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 126 (V126G)
Ref Sequence ENSEMBL: ENSMUSP00000139997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096482] [ENSMUST00000110585] [ENSMUST00000190131]
Predicted Effect probably benign
Transcript: ENSMUST00000096482
AA Change: V161G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000094225
Gene: ENSMUSG00000054115
AA Change: V161G

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
LRR 205 229 1.27e2 SMART
LRR 230 254 1.28e1 SMART
LRR 255 280 2.91e1 SMART
LRR 334 359 2.83e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110585
AA Change: V161G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106215
Gene: ENSMUSG00000054115
AA Change: V161G

DomainStartEndE-ValueType
FBOX 100 140 3.7e-8 SMART
Blast:LRR 205 229 5e-7 BLAST
Blast:LRR 229 253 3e-7 BLAST
Blast:LRR 255 284 3e-10 BLAST
Blast:LRR 309 334 3e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000190131
AA Change: V126G

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000139997
Gene: ENSMUSG00000054115
AA Change: V126G

DomainStartEndE-ValueType
FBOX 65 105 2.3e-10 SMART
LRR 170 194 5.3e-1 SMART
LRR 195 219 5.3e-2 SMART
LRR 220 245 1.2e-1 SMART
LRR 299 324 1.2e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191316
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class; in addition to an F-box, this protein contains 10 tandem leucine-rich repeats. This protein is an essential element of the cyclin A-CDK2 S-phase kinase. It specifically recognizes phosphorylated cyclin-dependent kinase inhibitor 1B (CDKN1B, also referred to as p27 or KIP1) predominantly in S phase and interacts with S-phase kinase-associated protein 1 (SKP1 or p19). In addition, this gene is established as a protooncogene causally involved in the pathogenesis of lymphomas. Alternative splicing of this gene generates three transcript variants encoding different isoforms. [provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced body weight, enlarged cell and nuclear sizes, polyploidy, reduced cell growth rate, overduplication of centrosomes, increased apoptosis rate, delayed wound healing, and aberrant immunoglobulin V(D)J recombination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1cf C A 19: 31,893,107 S3* probably null Het
Adgrv1 C T 13: 81,476,631 V3740I probably benign Het
Aida T C 1: 183,297,583 F22S probably damaging Het
Ankrd65 A T 4: 155,792,071 D220V probably damaging Het
Antxr2 A T 5: 97,975,350 C279* probably null Het
Ap3b1 T C 13: 94,408,812 V191A probably damaging Het
Arhgef28 T C 13: 97,981,376 K595E probably benign Het
Atp12a A G 14: 56,370,848 T98A probably benign Het
Cdcp1 A T 9: 123,185,362 S116T probably benign Het
Chrm1 T C 19: 8,679,218 F429S possibly damaging Het
Ckap5 C A 2: 91,562,958 Q395K possibly damaging Het
Cntn4 T A 6: 106,679,297 I853K probably benign Het
Cyp2g1 G A 7: 26,809,682 probably null Het
Dhx57 C T 17: 80,245,728 V1257I possibly damaging Het
Disp1 A T 1: 183,087,742 V1038D probably damaging Het
Dmxl2 A T 9: 54,451,030 S462T possibly damaging Het
Exoc3l A G 8: 105,293,060 probably null Het
Fam210a T C 18: 68,276,096 T48A probably benign Het
Fbxw5 G A 2: 25,503,274 probably null Het
Fkbp9 T C 6: 56,873,449 C437R probably damaging Het
Gpc5 A G 14: 115,399,279 K458R probably benign Het
Grik2 C A 10: 49,244,343 G56* probably null Het
Igsf10 T C 3: 59,331,285 T492A probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Lrrc51 T C 7: 101,913,438 Y145C probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Mapkbp1 A T 2: 120,018,548 I682F possibly damaging Het
Mttp A T 3: 138,103,193 V718D probably damaging Het
Myt1l T A 12: 29,895,273 D1012E unknown Het
Nbn G A 4: 15,971,771 G301D probably benign Het
Ncstn T A 1: 172,066,772 S677C possibly damaging Het
Nod1 C A 6: 54,944,233 probably null Het
Nos1ap A G 1: 170,514,637 V52A possibly damaging Het
Olfr1450 T A 19: 12,953,691 I34N probably damaging Het
Olfr191 T A 16: 59,086,343 I47F probably benign Het
Olfr568 T G 7: 102,877,656 Y179D probably damaging Het
Olfr619 T A 7: 103,603,675 L7* probably null Het
Phf13 T C 4: 151,992,505 I77V probably benign Het
Pias2 A G 18: 77,120,129 K230E probably damaging Het
Poli A G 18: 70,509,464 L469P probably damaging Het
Prag1 A T 8: 36,140,023 T973S possibly damaging Het
Prpf40b C A 15: 99,305,561 H101Q probably damaging Het
Prss50 T C 9: 110,862,489 V287A possibly damaging Het
Rbm25 C T 12: 83,668,150 probably benign Het
Rcor2 T C 19: 7,268,972 V4A probably damaging Het
Rnf180 T C 13: 105,270,991 T17A probably benign Het
Robo3 A T 9: 37,429,144 V179E probably damaging Het
Sacs T A 14: 61,209,009 S2835T probably damaging Het
Serpinb3c T A 1: 107,271,702 H363L probably damaging Het
Setd1a T C 7: 127,796,669 probably benign Het
Snph G A 2: 151,594,478 Q108* probably null Het
Snrpa1 T A 7: 66,069,498 V144E probably damaging Het
Tifab T C 13: 56,176,435 E65G probably damaging Het
Tmem201 A T 4: 149,719,575 Y468N probably damaging Het
Tpcn1 T C 5: 120,549,515 N388S possibly damaging Het
Tssk4 A G 14: 55,650,572 Q75R probably null Het
Tuba4a T C 1: 75,215,903 N356D probably benign Het
Ugt2b5 T A 5: 87,139,618 D230V probably benign Het
Ush2a T C 1: 188,916,064 V4622A probably benign Het
Vmn2r11 T G 5: 109,053,858 Y260S possibly damaging Het
Vmn2r89 C A 14: 51,456,236 H348N possibly damaging Het
Vmn2r96 A T 17: 18,597,726 M714L probably benign Het
Wdr92 A T 11: 17,227,183 E180D probably benign Het
Zbtb18 T C 1: 177,447,763 S221P probably benign Het
Zfp418 A G 7: 7,181,790 T251A probably benign Het
Zmynd15 A G 11: 70,463,502 Y267C probably damaging Het
Other mutations in Skp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00841:Skp2 APN 15 9139487 missense probably benign 0.00
IGL02135:Skp2 APN 15 9125147 missense probably benign
R0050:Skp2 UTSW 15 9125091 missense probably benign 0.03
R0129:Skp2 UTSW 15 9125193 missense probably damaging 1.00
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R0238:Skp2 UTSW 15 9127884 critical splice donor site probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1404:Skp2 UTSW 15 9116925 nonsense probably null
R1503:Skp2 UTSW 15 9127911 missense probably damaging 1.00
R1746:Skp2 UTSW 15 9139443 missense possibly damaging 0.58
R2031:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2034:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2087:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2088:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2090:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R2091:Skp2 UTSW 15 9113698 missense probably damaging 1.00
R4272:Skp2 UTSW 15 9116860 critical splice donor site probably null
R4428:Skp2 UTSW 15 9116947 missense probably benign 0.21
R4747:Skp2 UTSW 15 9113839 missense possibly damaging 0.93
R5734:Skp2 UTSW 15 9139479 missense possibly damaging 0.85
R6963:Skp2 UTSW 15 9139428 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGTTCTCCCGAGGAATCAGACAGC -3'
(R):5'- GTGACTTTGAGGGTCCCCAGAATTG -3'

Sequencing Primer
(F):5'- CCAGGTTGCAAATCTGTCG -3'
(R):5'- CCCCAGAATTGGCTTTGGC -3'
Posted On2014-05-09