Incidental Mutation 'R1661:Olfr1279'
ID186720
Institutional Source Beutler Lab
Gene Symbol Olfr1279
Ensembl Gene ENSMUSG00000109813
Gene Nameolfactory receptor 1279
SynonymsMOR245-12, GA_x6K02T2Q125-72357646-72358581
MMRRC Submission 039697-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1661 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location111300635-111309043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111306771 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 189 (C189R)
Ref Sequence ENSEMBL: ENSMUSP00000149972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062407] [ENSMUST00000090329] [ENSMUST00000213823] [ENSMUST00000216697]
Predicted Effect probably damaging
Transcript: ENSMUST00000062407
AA Change: C189R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052153
Gene: ENSMUSG00000108931
AA Change: C189R

DomainStartEndE-ValueType
Pfam:7tm_4 31 305 7.2e-45 PFAM
Pfam:7TM_GPCR_Srsx 34 302 2.4e-5 PFAM
Pfam:7tm_1 41 287 2e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000090329
AA Change: C191R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087801
Gene: ENSMUSG00000109813
AA Change: C191R

DomainStartEndE-ValueType
Pfam:7tm_4 33 306 1.7e-44 PFAM
Pfam:7TM_GPCR_Srsx 36 300 3.2e-5 PFAM
Pfam:7tm_1 43 289 7.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213823
AA Change: C189R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216697
AA Change: C189R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.068 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Adamts9 G T 6: 92,880,623 Q895K possibly damaging Het
Amotl2 T A 9: 102,730,096 I701N probably damaging Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Appbp2 T C 11: 85,210,110 probably null Het
Arhgap33 A C 7: 30,532,323 C113W probably damaging Het
Asprv1 A G 6: 86,628,736 N188S probably damaging Het
Atp8a2 T C 14: 59,860,186 I798V possibly damaging Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Cep89 A G 7: 35,417,680 T236A possibly damaging Het
Cfap61 T C 2: 146,035,319 probably null Het
Cog2 T C 8: 124,542,890 F390L probably benign Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Ddb1 A T 19: 10,629,080 Y1114F probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Dync1h1 T C 12: 110,656,357 F3494L probably damaging Het
F7 A G 8: 13,035,209 I412V probably benign Het
Fam208b C T 13: 3,573,860 S2030N possibly damaging Het
Fam222b A G 11: 78,155,161 Y388C probably damaging Het
Fam227a G A 15: 79,620,677 probably null Het
Fam71f2 G C 6: 29,285,938 R132P probably damaging Het
Fbxo32 A C 15: 58,191,469 V156G probably damaging Het
Fem1b C T 9: 62,797,274 V235I probably damaging Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gm996 T C 2: 25,579,155 D248G possibly damaging Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ighmbp2 A G 19: 3,267,246 L542P probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itpr1 A G 6: 108,482,897 N2051D probably benign Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Megf8 A G 7: 25,363,847 T2543A probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nnmt A G 9: 48,604,874 S29P probably benign Het
Nrde2 A T 12: 100,149,860 S122T probably benign Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Olfr853 C T 9: 19,537,328 V201I probably benign Het
Pced1b A G 15: 97,384,713 H211R probably benign Het
Pcsk5 A T 19: 17,447,574 S1622T probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Phf11a A T 14: 59,280,788 L170H probably damaging Het
Ppil6 A G 10: 41,514,180 D307G probably benign Het
Ppp6r2 A G 15: 89,253,051 D6G possibly damaging Het
Psmd12 A T 11: 107,491,906 K212N probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ryr1 A T 7: 29,101,738 I860N probably damaging Het
Saal1 A T 7: 46,692,800 N406K possibly damaging Het
Sh3pxd2a A T 19: 47,278,320 Y277N probably damaging Het
Slitrk1 A T 14: 108,911,927 Y451N probably damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Smarcd1 A T 15: 99,707,638 probably null Het
Smc3 A G 19: 53,625,065 D403G probably benign Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Other mutations in Olfr1279
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Olfr1279 APN 2 111306621 missense probably benign 0.19
IGL01355:Olfr1279 APN 2 111307093 missense probably benign 0.00
IGL01864:Olfr1279 APN 2 111307055 missense probably damaging 1.00
IGL02160:Olfr1279 APN 2 111306798 missense probably benign 0.02
IGL02183:Olfr1279 APN 2 111306418 missense probably damaging 0.98
R0280:Olfr1279 UTSW 2 111307072 missense possibly damaging 0.48
R0636:Olfr1279 UTSW 2 111306412 missense probably benign 0.06
R0732:Olfr1279 UTSW 2 111306980 nonsense probably null
R1665:Olfr1279 UTSW 2 111306771 missense probably damaging 1.00
R2251:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2252:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2253:Olfr1279 UTSW 2 111306310 missense probably damaging 1.00
R2473:Olfr1279 UTSW 2 111306891 missense probably damaging 1.00
R3408:Olfr1279 UTSW 2 111306505 missense probably damaging 1.00
R5020:Olfr1279 UTSW 2 111306292 missense probably benign 0.01
R5634:Olfr1279 UTSW 2 111307092 missense probably benign
R5647:Olfr1279 UTSW 2 111307047 missense possibly damaging 0.67
R6782:Olfr1279 UTSW 2 111306745 missense probably damaging 1.00
R6911:Olfr1279 UTSW 2 111306273 missense probably benign 0.00
X0021:Olfr1279 UTSW 2 111306588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAACCTGTCTTTGAACGATGTG -3'
(R):5'- ACAAGCGCCTTTGACAAGTCCC -3'

Sequencing Primer
(F):5'- ATGGCCTTTGACAGGTACAC -3'
(R):5'- AAGTCCCCTGAAGACCTTTGC -3'
Posted On2014-05-09