Incidental Mutation 'R1662:Atic'
ID186803
Institutional Source Beutler Lab
Gene Symbol Atic
Ensembl Gene ENSMUSG00000026192
Gene Name5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase
Synonyms2610509C24Rik
MMRRC Submission 039698-MU
Accession Numbers

Genbank: NM_026195; MGI: 1351352

Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71557150-71579631 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71576127 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 438 (D438E)
Ref Sequence ENSEMBL: ENSMUSP00000027384 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027384]
Predicted Effect probably benign
Transcript: ENSMUST00000027384
AA Change: D438E

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027384
Gene: ENSMUSG00000026192
AA Change: D438E

DomainStartEndE-ValueType
MGS 16 130 1.31e-46 SMART
AICARFT_IMPCHas 135 462 4.84e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154855
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155769
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bifunctional protein that catalyzes the last two steps of the de novo purine biosynthetic pathway. The N-terminal domain has phosphoribosylaminoimidazolecarboxamide formyltransferase activity, and the C-terminal domain has IMP cyclohydrolase activity. A mutation in this gene results in AICA-ribosiduria. [provided by RefSeq, Sep 2009]
Allele List at MGI

All alleles(2) : Gene trapped(2)

Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Atic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01947:Atic APN 1 71570837 splice site probably benign
IGL02368:Atic APN 1 71564565 splice site probably benign
IGL03291:Atic APN 1 71570922 missense probably benign 0.06
3-1:Atic UTSW 1 71560895 nonsense probably null
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0039:Atic UTSW 1 71577850 missense possibly damaging 0.95
R0558:Atic UTSW 1 71563788 missense probably benign 0.00
R1222:Atic UTSW 1 71559279 missense probably damaging 1.00
R2075:Atic UTSW 1 71576127 missense probably benign 0.06
R2402:Atic UTSW 1 71569057 nonsense probably null
R2475:Atic UTSW 1 71559269 missense probably damaging 1.00
R2566:Atic UTSW 1 71568971 missense probably damaging 0.98
R3711:Atic UTSW 1 71578579 missense probably benign 0.02
R5115:Atic UTSW 1 71557275 critical splice donor site probably null
R5215:Atic UTSW 1 71564507 missense probably damaging 0.98
R5444:Atic UTSW 1 71576717 missense probably damaging 0.96
R6348:Atic UTSW 1 71576698 missense probably damaging 1.00
R6370:Atic UTSW 1 71578660 missense probably damaging 1.00
R6374:Atic UTSW 1 71564941 missense probably damaging 1.00
R6909:Atic UTSW 1 71576846 intron probably null
R7224:Atic UTSW 1 71570855 missense probably benign
R7444:Atic UTSW 1 71563787 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- GTGCAGCATAATTTGTCCATCTGGC -3'
(R):5'- AGGCAGCTTCCTCTAAGCAGGAAC -3'

Sequencing Primer
(F):5'- TGTCACTGAGGGACCTAACTG -3'
(R):5'- TTCCTCTAAGCAGGAACCAGTG -3'
Posted On2014-05-09