Incidental Mutation 'R1662:Abca1'
ID186827
Institutional Source Beutler Lab
Gene Symbol Abca1
Ensembl Gene ENSMUSG00000015243
Gene NameATP-binding cassette, sub-family A (ABC1), member 1
SynonymsABC1
MMRRC Submission 039698-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location53030787-53159895 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to A at 53090251 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030010 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030010] [ENSMUST00000030010] [ENSMUST00000030010]
Predicted Effect probably null
Transcript: ENSMUST00000030010
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030010
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000030010
SMART Domains Protein: ENSMUSP00000030010
Gene: ENSMUSG00000015243

DomainStartEndE-ValueType
transmembrane domain 25 47 N/A INTRINSIC
Pfam:ABC2_membrane_3 395 841 4.9e-14 PFAM
AAA 925 1122 4.2e-10 SMART
low complexity region 1137 1150 N/A INTRINSIC
Pfam:ABC2_membrane_3 1344 1869 1.7e-53 PFAM
low complexity region 1890 1899 N/A INTRINSIC
AAA 1938 2123 3.04e-7 SMART
low complexity region 2176 2187 N/A INTRINSIC
low complexity region 2222 2237 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. In humans, this protein functions as a cholesterol efflux pump in the cellular lipid removal pathway. Mutations in the human gene have been associated with Tangier's disease and familial high-density lipoprotein deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Many homozygous null mutants die perinatally with placental defects. Survivors show altered steroidogenesis, defective lipid export in Golgi, low serum cholesterol, lipid accumulation in macrophages and lung, reduced fertility and kidney and heart defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Spata31d1b A G 13: 59,716,628 D530G probably benign Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Abca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Abca1 APN 4 53059255 critical splice donor site probably null
IGL00778:Abca1 APN 4 53086132 missense probably benign
IGL01013:Abca1 APN 4 53038185 nonsense probably null
IGL01510:Abca1 APN 4 53143979 missense probably damaging 0.97
IGL01608:Abca1 APN 4 53038158 missense probably damaging 1.00
IGL01845:Abca1 APN 4 53090297 missense probably damaging 1.00
IGL02048:Abca1 APN 4 53069831 missense probably damaging 1.00
IGL02249:Abca1 APN 4 53068739 nonsense probably null
IGL02569:Abca1 APN 4 53034061 missense probably damaging 1.00
IGL02622:Abca1 APN 4 53034046 missense probably damaging 0.99
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0042:Abca1 UTSW 4 53059245 splice site probably benign
R0050:Abca1 UTSW 4 53069910 splice site probably benign
R0107:Abca1 UTSW 4 53080834 missense probably benign 0.00
R0127:Abca1 UTSW 4 53067155 missense probably benign 0.00
R0178:Abca1 UTSW 4 53081953 missense possibly damaging 0.89
R0207:Abca1 UTSW 4 53086039 missense probably damaging 0.97
R0267:Abca1 UTSW 4 53046105 missense probably damaging 1.00
R0269:Abca1 UTSW 4 53044228 missense probably benign
R0586:Abca1 UTSW 4 53092860 missense probably benign 0.00
R0587:Abca1 UTSW 4 53107035 missense probably benign 0.00
R1403:Abca1 UTSW 4 53059253 splice site probably benign
R1404:Abca1 UTSW 4 53059253 splice site probably benign
R1405:Abca1 UTSW 4 53059253 splice site probably benign
R1558:Abca1 UTSW 4 53092887 missense probably null 0.00
R1655:Abca1 UTSW 4 53050964 missense probably benign
R1769:Abca1 UTSW 4 53074325 missense probably damaging 1.00
R1898:Abca1 UTSW 4 53071977 missense probably benign 0.08
R1945:Abca1 UTSW 4 53061509 frame shift probably null
R1966:Abca1 UTSW 4 53050409 missense probably damaging 1.00
R2055:Abca1 UTSW 4 53069881 missense probably benign
R2185:Abca1 UTSW 4 53089830 missense probably benign 0.12
R2202:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2203:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R2204:Abca1 UTSW 4 53090291 missense probably damaging 0.96
R3056:Abca1 UTSW 4 53127626 missense probably benign
R3849:Abca1 UTSW 4 53061481 splice site probably benign
R3850:Abca1 UTSW 4 53061481 splice site probably benign
R3906:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R3908:Abca1 UTSW 4 53067151 missense possibly damaging 0.84
R4050:Abca1 UTSW 4 53044144 missense probably damaging 1.00
R4204:Abca1 UTSW 4 53090369 missense probably benign 0.00
R4225:Abca1 UTSW 4 53085106 missense possibly damaging 0.87
R4577:Abca1 UTSW 4 53062568 missense possibly damaging 0.94
R4979:Abca1 UTSW 4 53085092 splice site probably null
R5022:Abca1 UTSW 4 53041570 frame shift probably null
R5168:Abca1 UTSW 4 53086070 missense probably benign
R5363:Abca1 UTSW 4 53132963 missense probably benign 0.00
R5439:Abca1 UTSW 4 53042381 missense possibly damaging 0.55
R5604:Abca1 UTSW 4 53067168 splice site probably null
R5614:Abca1 UTSW 4 53046132 missense probably damaging 1.00
R5810:Abca1 UTSW 4 53079631 missense probably benign
R6001:Abca1 UTSW 4 53075555 missense possibly damaging 0.68
R6151:Abca1 UTSW 4 53085261 missense probably benign
R6185:Abca1 UTSW 4 53078089 missense probably benign 0.31
R6262:Abca1 UTSW 4 53092917 missense probably benign 0.01
R6455:Abca1 UTSW 4 53042376 missense probably damaging 0.98
R6472:Abca1 UTSW 4 53085991 critical splice donor site probably null
R6564:Abca1 UTSW 4 53034031 missense possibly damaging 0.85
R6720:Abca1 UTSW 4 53083733 missense probably damaging 1.00
R6903:Abca1 UTSW 4 53143952 missense probably benign 0.17
R6960:Abca1 UTSW 4 53072924 missense probably benign 0.00
R7065:Abca1 UTSW 4 53074233 missense probably damaging 0.98
R7142:Abca1 UTSW 4 53082050 missense probably damaging 1.00
R7322:Abca1 UTSW 4 53067151 missense probably damaging 0.97
X0023:Abca1 UTSW 4 53049038 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TACTCAAGGCTGGGGATATGGAGC -3'
(R):5'- TCGAGCACTGAGGAAAGACCTCAC -3'

Sequencing Primer
(F):5'- GGGATATGGAGCCCAAGATTAC -3'
(R):5'- tgataggtgatgtgggaggg -3'
Posted On2014-05-09