Incidental Mutation 'R1662:Spata31d1b'
ID186871
Institutional Source Beutler Lab
Gene Symbol Spata31d1b
Ensembl Gene ENSMUSG00000091311
Gene Namespermatogenesis associated 31 subfamily D, member 1B
SynonymsFam75d1b, Gm4934
MMRRC Submission 039698-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1662 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location59712284-59719295 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 59716628 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 530 (D530G)
Ref Sequence ENSEMBL: ENSMUSP00000130813 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165133]
Predicted Effect probably benign
Transcript: ENSMUST00000165133
AA Change: D530G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000130813
Gene: ENSMUSG00000091311
AA Change: D530G

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:DUF4599 65 149 3.9e-10 PFAM
low complexity region 170 188 N/A INTRINSIC
low complexity region 206 229 N/A INTRINSIC
low complexity region 352 360 N/A INTRINSIC
Pfam:FAM75 402 774 1.1e-116 PFAM
low complexity region 883 895 N/A INTRINSIC
low complexity region 983 1001 N/A INTRINSIC
low complexity region 1152 1162 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 76 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730409E04Rik T A 4: 126,611,682 M1K probably null Het
5730507C01Rik A C 12: 18,531,966 R119S possibly damaging Het
Abca1 T A 4: 53,090,251 probably null Het
Aff1 G A 5: 103,841,057 G830D probably damaging Het
AI987944 T C 7: 41,374,449 T369A possibly damaging Het
Aoah A G 13: 21,000,113 probably null Het
Arhgap40 C G 2: 158,539,270 C349W probably damaging Het
Atic T A 1: 71,576,127 D438E probably benign Het
Barhl2 A T 5: 106,453,499 M338K probably benign Het
Btd T C 14: 31,666,790 V156A probably damaging Het
Ccdc82 T C 9: 13,262,772 V319A probably damaging Het
Celsr1 G T 15: 86,031,062 N903K probably damaging Het
Cenpf T A 1: 189,657,771 N1288I probably damaging Het
Ciao1 G A 2: 127,244,937 T252I probably benign Het
Cma2 T C 14: 55,973,116 C87R probably damaging Het
Cops7a T A 6: 124,962,438 R83W probably damaging Het
Cxcr6 A T 9: 123,810,548 M205L possibly damaging Het
Dcc A G 18: 71,420,338 L749P probably benign Het
Dync1i2 C T 2: 71,250,979 T484I possibly damaging Het
Epas1 A T 17: 86,829,027 K742N probably damaging Het
Evc2 A G 5: 37,348,750 T138A probably benign Het
F5 T C 1: 164,207,888 I1877T probably damaging Het
Fat1 T G 8: 44,953,164 V984G probably benign Het
Fat4 T A 3: 38,980,779 V2860D probably damaging Het
Foxn4 C T 5: 114,256,894 R324Q probably benign Het
Gapdhs C T 7: 30,737,002 R120H probably damaging Het
Gcnt3 T C 9: 70,034,377 D303G probably benign Het
Gm16432 A G 1: 178,046,986 K140E unknown Het
Gng11 A T 6: 4,008,066 Y43F probably benign Het
Hectd4 A C 5: 121,317,245 M651L probably benign Het
Ifngr2 T A 16: 91,560,596 Y200N probably benign Het
Iqgap3 T C 3: 88,098,401 V512A probably benign Het
Kdm2a A C 19: 4,328,212 D187E probably damaging Het
Klhl8 A G 5: 103,872,045 V370A probably damaging Het
Kmt2a G A 9: 44,836,670 probably benign Het
Krt12 C A 11: 99,420,824 V184F probably benign Het
Lrrc8c A T 5: 105,606,757 I133F probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1a C G 2: 121,306,408 S2568R possibly damaging Het
Mbnl1 C A 3: 60,625,172 Q301K probably damaging Het
Med12l A T 3: 59,093,617 K724N probably damaging Het
Mroh2a A C 1: 88,241,618 I672L probably benign Het
Mybph C T 1: 134,193,636 P45S probably benign Het
Myo15 T A 11: 60,501,701 S2157T probably damaging Het
Olfr113 G T 17: 37,575,273 T50K probably damaging Het
Olfr193 T C 16: 59,110,604 E2G probably benign Het
Olfr374 T C 8: 72,109,779 V71A probably benign Het
Olfr721-ps1 T A 14: 14,407,880 Y217* probably null Het
Otogl A G 10: 107,798,357 I1419T possibly damaging Het
Ovol1 A T 19: 5,551,639 F118L probably damaging Het
Pak7 T C 2: 136,116,760 D136G probably damaging Het
Pik3r2 T C 8: 70,770,606 Y417C probably damaging Het
Ppp2r2a T C 14: 67,016,603 N372S probably benign Het
Prss30 G T 17: 23,972,832 N238K possibly damaging Het
Prss33 C A 17: 23,834,811 probably null Het
Ptpn4 T C 1: 119,765,058 E187G probably damaging Het
Ptprg A T 14: 12,207,357 N100I probably damaging Het
Rbpms2 T C 9: 65,651,042 V130A probably benign Het
Rdh7 A T 10: 127,888,612 M1K probably null Het
Rtp3 A C 9: 110,986,683 S205A probably benign Het
Ryr3 G T 2: 112,709,273 D3207E probably damaging Het
Scn9a T A 2: 66,483,459 T1972S probably benign Het
Scnn1b T C 7: 121,902,328 V122A probably benign Het
Slc15a4 A G 5: 127,608,979 L213S probably damaging Het
Slc27a5 T A 7: 12,991,246 I425F probably damaging Het
Tcf25 T A 8: 123,381,550 S115T probably benign Het
Tet2 A G 3: 133,466,852 L1883P possibly damaging Het
Trim21 T A 7: 102,561,898 R205* probably null Het
Ttc23 G T 7: 67,725,321 probably null Het
Unc13d T C 11: 116,068,673 K658R probably null Het
Vmn1r43 A G 6: 89,869,590 F305L possibly damaging Het
Vmn2r2 A T 3: 64,117,130 C677S probably benign Het
Wnt5a T C 14: 28,518,343 M150T probably benign Het
Ythdc1 G A 5: 86,828,122 probably null Het
Zcchc6 T C 13: 59,799,903 E466G possibly damaging Het
Zdbf2 A T 1: 63,304,249 R596* probably null Het
Other mutations in Spata31d1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01525:Spata31d1b APN 13 59712466 missense probably benign 0.06
IGL02317:Spata31d1b APN 13 59718040 missense probably damaging 0.99
IGL02885:Spata31d1b APN 13 59719127 utr 3 prime probably benign
R0017:Spata31d1b UTSW 13 59716069 missense probably benign
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0071:Spata31d1b UTSW 13 59715349 missense probably benign 0.26
R0595:Spata31d1b UTSW 13 59716277 missense probably benign 0.09
R0961:Spata31d1b UTSW 13 59717804 missense possibly damaging 0.91
R1054:Spata31d1b UTSW 13 59717518 missense probably damaging 0.96
R1124:Spata31d1b UTSW 13 59716654 missense probably benign
R1338:Spata31d1b UTSW 13 59718161 frame shift probably null
R1539:Spata31d1b UTSW 13 59715919 missense possibly damaging 0.46
R1688:Spata31d1b UTSW 13 59715460 missense possibly damaging 0.61
R1776:Spata31d1b UTSW 13 59716567 missense probably benign
R1793:Spata31d1b UTSW 13 59715965 missense probably benign
R1838:Spata31d1b UTSW 13 59715857 missense probably benign
R1838:Spata31d1b UTSW 13 59717465 missense probably benign 0.00
R1861:Spata31d1b UTSW 13 59717336 missense possibly damaging 0.64
R1903:Spata31d1b UTSW 13 59718068 missense probably damaging 0.99
R1940:Spata31d1b UTSW 13 59718021 missense possibly damaging 0.91
R1994:Spata31d1b UTSW 13 59716380 missense probably benign
R1995:Spata31d1b UTSW 13 59716380 missense probably benign
R2407:Spata31d1b UTSW 13 59716846 missense possibly damaging 0.64
R3692:Spata31d1b UTSW 13 59717891 missense probably benign 0.03
R4576:Spata31d1b UTSW 13 59716861 missense probably damaging 0.98
R4734:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4742:Spata31d1b UTSW 13 59716612 missense probably damaging 0.98
R4749:Spata31d1b UTSW 13 59718358 missense probably damaging 1.00
R4806:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4808:Spata31d1b UTSW 13 59715721 missense probably benign 0.32
R4844:Spata31d1b UTSW 13 59718355 missense possibly damaging 0.85
R4942:Spata31d1b UTSW 13 59717103 missense possibly damaging 0.70
R4953:Spata31d1b UTSW 13 59716283 missense probably damaging 0.96
R5093:Spata31d1b UTSW 13 59716024 missense possibly damaging 0.84
R5169:Spata31d1b UTSW 13 59716495 missense probably damaging 1.00
R5384:Spata31d1b UTSW 13 59718218 missense possibly damaging 0.68
R5386:Spata31d1b UTSW 13 59719052 missense possibly damaging 0.95
R5502:Spata31d1b UTSW 13 59716672 missense probably damaging 1.00
R5751:Spata31d1b UTSW 13 59718973 missense probably benign 0.03
R6054:Spata31d1b UTSW 13 59715650 missense probably benign
R6433:Spata31d1b UTSW 13 59717185 missense probably damaging 0.99
R6571:Spata31d1b UTSW 13 59717455 missense probably benign
R6980:Spata31d1b UTSW 13 59715422 missense probably benign 0.26
R7047:Spata31d1b UTSW 13 59712435 missense probably damaging 1.00
R7064:Spata31d1b UTSW 13 59716141 missense probably benign
R7147:Spata31d1b UTSW 13 59718214 missense probably benign 0.28
R7273:Spata31d1b UTSW 13 59717632 missense probably benign
R7359:Spata31d1b UTSW 13 59712490 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCGTCAAGCAGCAAAGGCAAG -3'
(R):5'- TTGGAGGAGCGACTTCCCAACAAG -3'

Sequencing Primer
(F):5'- AGCATTGGTCTGCTTCAACAG -3'
(R):5'- CCAACAAGACCTTGGGAGGTG -3'
Posted On2014-05-09