Incidental Mutation 'R1663:Mccc1'
ID186905
Institutional Source Beutler Lab
Gene Symbol Mccc1
Ensembl Gene ENSMUSG00000027709
Gene Namemethylcrotonoyl-Coenzyme A carboxylase 1 (alpha)
Synonyms2310058B18Rik, MCCA, MCCalpha, 1810045E08Rik
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location35959312-36000678 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 35978933 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 354 (W354L)
Ref Sequence ENSEMBL: ENSMUSP00000029259 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029259] [ENSMUST00000199113] [ENSMUST00000200163]
Predicted Effect probably damaging
Transcript: ENSMUST00000029259
AA Change: W354L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000029259
Gene: ENSMUSG00000027709
AA Change: W354L

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 4.7e-50 PFAM
Pfam:ATP-grasp_4 156 337 3.7e-20 PFAM
Pfam:RimK 158 358 1e-6 PFAM
Pfam:CPSase_L_D2 159 367 2.8e-79 PFAM
Pfam:ATP-grasp_3 160 339 8.1e-9 PFAM
Pfam:Dala_Dala_lig_C 165 335 1.2e-16 PFAM
Pfam:ATP-grasp 166 337 3.7e-13 PFAM
Biotin_carb_C 379 486 7.14e-48 SMART
Pfam:Biotin_lipoyl 644 710 1.1e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196662
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198634
Predicted Effect probably benign
Transcript: ENSMUST00000199113
SMART Domains Protein: ENSMUSP00000143266
Gene: ENSMUSG00000027709

DomainStartEndE-ValueType
low complexity region 2 9 N/A INTRINSIC
Pfam:CPSase_L_chain 44 153 3.5e-48 PFAM
Pfam:ATP-grasp_4 156 253 4.1e-10 PFAM
Pfam:CPSase_L_D2 159 253 1.2e-24 PFAM
Pfam:Dala_Dala_lig_C 165 254 1.6e-8 PFAM
Pfam:ATP-grasp 166 253 8.3e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000200163
AA Change: W134L

PolyPhen 2 Score 0.900 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143039
Gene: ENSMUSG00000027709
AA Change: W134L

DomainStartEndE-ValueType
Pfam:Dala_Dala_lig_C 1 115 3.8e-8 PFAM
Pfam:ATP-grasp_4 1 117 1.5e-9 PFAM
Pfam:CPSase_L_D2 1 147 3.9e-59 PFAM
Pfam:Biotin_carb_C 159 200 1.5e-9 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the large subunit of 3-methylcrotonyl-CoA carboxylase. This enzyme functions as a heterodimer and catalyzes the carboxylation of 3-methylcrotonyl-CoA to form 3-methylglutaconyl-CoA. Mutations in this gene are associated with 3-Methylcrotonylglycinuria, an autosomal recessive disorder of leucine catabolism. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Mccc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01483:Mccc1 APN 3 35989860 missense probably damaging 0.99
IGL01601:Mccc1 APN 3 35989952 missense probably benign 0.00
IGL01671:Mccc1 APN 3 35964460 missense probably benign
IGL01784:Mccc1 APN 3 35976748 missense probably damaging 0.99
IGL01878:Mccc1 APN 3 35975892 missense probably damaging 1.00
IGL02088:Mccc1 APN 3 35974202 missense probably damaging 1.00
IGL02709:Mccc1 APN 3 35990739 makesense probably null
IGL02932:Mccc1 APN 3 35960029 missense possibly damaging 0.86
IGL02972:Mccc1 APN 3 35985089 missense possibly damaging 0.58
IGL03145:Mccc1 APN 3 35968446 missense probably benign
P0019:Mccc1 UTSW 3 35964395 missense probably benign 0.00
R0244:Mccc1 UTSW 3 35990047 critical splice donor site probably null
R0391:Mccc1 UTSW 3 35963570 splice site probably benign
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1466:Mccc1 UTSW 3 35974286 missense probably benign 0.01
R1591:Mccc1 UTSW 3 35989857 missense probably damaging 1.00
R1827:Mccc1 UTSW 3 35985001 missense probably damaging 1.00
R3800:Mccc1 UTSW 3 36000509 missense probably damaging 1.00
R4290:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4291:Mccc1 UTSW 3 35990068 missense probably damaging 0.98
R4707:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4757:Mccc1 UTSW 3 35995917 missense probably benign 0.32
R4783:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4785:Mccc1 UTSW 3 35975873 missense probably damaging 0.99
R4798:Mccc1 UTSW 3 35985001 missense probably damaging 0.99
R4807:Mccc1 UTSW 3 35985046 missense probably damaging 1.00
R4915:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R4917:Mccc1 UTSW 3 35997554 missense probably benign 0.00
R5010:Mccc1 UTSW 3 35979017 missense probably benign 0.15
R5106:Mccc1 UTSW 3 35972564 missense probably benign 0.22
R5168:Mccc1 UTSW 3 35990780 nonsense probably null
R5241:Mccc1 UTSW 3 35974196 missense probably benign 0.03
R5444:Mccc1 UTSW 3 35976742 missense probably benign 0.00
R5677:Mccc1 UTSW 3 35990048 critical splice donor site probably null
R5838:Mccc1 UTSW 3 35985082 missense possibly damaging 0.88
R5881:Mccc1 UTSW 3 35964382 missense probably benign 0.00
R6248:Mccc1 UTSW 3 35990164 missense probably damaging 1.00
R6381:Mccc1 UTSW 3 35976727 missense probably benign 0.13
R6564:Mccc1 UTSW 3 35976676 missense probably damaging 1.00
R6612:Mccc1 UTSW 3 35993930 missense probably benign 0.01
R6769:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R6771:Mccc1 UTSW 3 35989843 critical splice donor site probably null
R7135:Mccc1 UTSW 3 35995818 missense probably damaging 1.00
R7236:Mccc1 UTSW 3 35983795 missense probably benign 0.13
R7274:Mccc1 UTSW 3 35989856 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGCAGCCTGAAAGGAGTCTG -3'
(R):5'- GAAGTCTGCGGTAGTGAAGTCAGTG -3'

Sequencing Primer
(F):5'- GTCTGGAATGTAATGTGTTCTCAAC -3'
(R):5'- gggaattgaaccagcaaggag -3'
Posted On2014-05-09