Incidental Mutation 'R1663:Sema3a'
ID186917
Institutional Source Beutler Lab
Gene Symbol Sema3a
Ensembl Gene ENSMUSG00000028883
Gene Namesema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
SynonymsSemad, semaphorin III, SemD, sema III, collapsin-1
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location13125414-13602565 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 13557125 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000128153 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030714] [ENSMUST00000095012] [ENSMUST00000137798]
Predicted Effect probably null
Transcript: ENSMUST00000030714
SMART Domains Protein: ENSMUSP00000030714
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000095012
SMART Domains Protein: ENSMUSP00000092621
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000137798
SMART Domains Protein: ENSMUSP00000128153
Gene: ENSMUSG00000028883

DomainStartEndE-ValueType
Sema 57 498 4.09e-219 SMART
PSI 516 568 3.03e-12 SMART
IG 583 669 3.54e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197552
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the semaphorin family and encodes a protein with an Ig-like C2-type (immunoglobulin-like) domain, a PSI domain and a Sema domain. This secreted protein can function as either a chemorepulsive agent, inhibiting axonal outgrowth, or as a chemoattractive agent, stimulating the growth of apical dendrites. In both cases, the protein is vital for normal neuronal pattern development. Increased expression of this protein is associated with schizophrenia and is seen in a variety of human tumor cell lines. Also, aberrant release of this protein is associated with the progression of Alzheimer's disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit patterning abnormalities of sensory and sympathetic neurons, abnormal embryonic bones and cartilaginous structures, cardiac defects, and high postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atf7ip A G 6: 136,603,324 Q1082R possibly damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Sema3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Sema3a APN 5 13473466 missense probably damaging 1.00
IGL01783:Sema3a APN 5 13561800 missense probably damaging 1.00
IGL02423:Sema3a APN 5 13565809 missense probably damaging 1.00
IGL02728:Sema3a APN 5 13565914 missense probably damaging 1.00
IGL02739:Sema3a APN 5 13451161 missense probably damaging 1.00
IGL02987:Sema3a APN 5 13565896 missense probably damaging 1.00
IGL03106:Sema3a APN 5 13599488 missense probably damaging 1.00
R0055:Sema3a UTSW 5 13400037 missense possibly damaging 0.92
R0334:Sema3a UTSW 5 13557301 missense probably damaging 0.99
R0684:Sema3a UTSW 5 13556527 critical splice acceptor site probably null
R0750:Sema3a UTSW 5 13557125 critical splice donor site probably null
R1204:Sema3a UTSW 5 13523175 critical splice donor site probably benign
R1221:Sema3a UTSW 5 13516223 missense probably benign
R1484:Sema3a UTSW 5 13473440 missense probably damaging 1.00
R2079:Sema3a UTSW 5 13451131 missense possibly damaging 0.95
R4165:Sema3a UTSW 5 13473397 critical splice acceptor site probably null
R4596:Sema3a UTSW 5 13570157 missense probably damaging 1.00
R4867:Sema3a UTSW 5 13451241 missense probably benign 0.05
R4904:Sema3a UTSW 5 13581098 missense probably damaging 1.00
R5107:Sema3a UTSW 5 13577604 nonsense probably null
R5327:Sema3a UTSW 5 13599389 missense probably benign 0.25
R5343:Sema3a UTSW 5 13473406 missense probably damaging 1.00
R5430:Sema3a UTSW 5 13565763 missense probably damaging 0.97
R5604:Sema3a UTSW 5 13473520 critical splice donor site probably null
R5774:Sema3a UTSW 5 13523164 missense probably damaging 1.00
R6057:Sema3a UTSW 5 13565865 missense probably damaging 1.00
R6110:Sema3a UTSW 5 13581001 missense probably damaging 1.00
R6132:Sema3a UTSW 5 13523175 critical splice donor site probably null
R6310:Sema3a UTSW 5 13557019 missense probably damaging 1.00
R6754:Sema3a UTSW 5 13599275 missense possibly damaging 0.94
R6788:Sema3a UTSW 5 13597616 missense possibly damaging 0.95
R6878:Sema3a UTSW 5 13455544 missense possibly damaging 0.88
X0064:Sema3a UTSW 5 13581098 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTACACACTTGCTTATGGAACGGC -3'
(R):5'- AATCAGTCTCAGTGCATGTCCACAG -3'

Sequencing Primer
(F):5'- ACTTGCTTATGGAACGGCTTTTC -3'
(R):5'- GATGTTGTGAACACTCCATAGACG -3'
Posted On2014-05-09