Incidental Mutation 'R1663:Atf7ip'
ID186929
Institutional Source Beutler Lab
Gene Symbol Atf7ip
Ensembl Gene ENSMUSG00000030213
Gene Nameactivating transcription factor 7 interacting protein
SynonymsMcaf1, 2610204M12Rik, AM, ATFa-associated Modulator
MMRRC Submission 039699-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.790) question?
Stock #R1663 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location136506167-136610862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136603324 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 1082 (Q1082R)
Ref Sequence ENSEMBL: ENSMUSP00000032335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032335]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032335
AA Change: Q1082R

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000032335
Gene: ENSMUSG00000030213
AA Change: Q1082R

DomainStartEndE-ValueType
internal_repeat_1 123 144 9.59e-5 PROSPERO
internal_repeat_1 143 164 9.59e-5 PROSPERO
low complexity region 184 212 N/A INTRINSIC
low complexity region 246 262 N/A INTRINSIC
low complexity region 284 303 N/A INTRINSIC
low complexity region 409 427 N/A INTRINSIC
low complexity region 567 582 N/A INTRINSIC
Pfam:ATF7IP_BD 598 813 5.5e-62 PFAM
low complexity region 864 889 N/A INTRINSIC
PDB:2RPQ|B 974 1017 5e-7 PDB
low complexity region 1022 1036 N/A INTRINSIC
low complexity region 1038 1050 N/A INTRINSIC
low complexity region 1101 1112 N/A INTRINSIC
low complexity region 1168 1192 N/A INTRINSIC
FN3 1194 1288 3.4e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185332
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ATF7IP is a multifunctional nuclear protein that associates with heterochromatin. It can act as a transcriptional coactivator or corepressor depending upon its binding partners (summary by Liu et al., 2009 [PubMed 19106100]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam3 T A 8: 24,687,933 T11S probably benign Het
Adgb T C 10: 10,339,675 M1529V possibly damaging Het
Ankrd36 T A 11: 5,620,126 D531E possibly damaging Het
Ankzf1 C T 1: 75,196,270 P337S probably damaging Het
Apc A G 18: 34,268,325 I55V probably damaging Het
Aplnr A G 2: 85,136,694 D21G possibly damaging Het
Apol10b A T 15: 77,588,714 F47I probably damaging Het
Arhgef5 G A 6: 43,276,965 A1131T probably damaging Het
Arrb2 A T 11: 70,437,603 Q83L probably damaging Het
Atl2 A G 17: 79,864,711 S28P probably damaging Het
Brd7 T C 8: 88,358,023 K89E possibly damaging Het
Cc2d1b A G 4: 108,623,547 T55A probably damaging Het
Ccdc18 A G 5: 108,216,090 E1217G probably damaging Het
Cdc42ep4 A T 11: 113,729,451 M38K probably damaging Het
Cldn14 A G 16: 93,919,278 S227P probably damaging Het
Clspn T A 4: 126,565,975 C332S probably benign Het
Col5a1 T C 2: 27,951,476 S370P unknown Het
Comp T C 8: 70,373,600 L10P possibly damaging Het
Dcc A T 18: 71,826,052 N216K probably damaging Het
Dcstamp C T 15: 39,754,944 Q250* probably null Het
Drd5 T C 5: 38,320,855 F397S probably benign Het
Dst T C 1: 34,163,385 S265P probably damaging Het
Enam A T 5: 88,503,994 S1046C probably damaging Het
Eno3 T C 11: 70,662,274 probably null Het
Fam13a G A 6: 58,954,372 R408* probably null Het
Gipc2 T A 3: 152,094,164 M310L probably benign Het
Gm14496 T C 2: 181,997,437 V440A probably benign Het
Gzmg A T 14: 56,156,808 C210S probably damaging Het
Helb G T 10: 120,105,433 A450E probably damaging Het
Hepacam2 A T 6: 3,483,439 I190N possibly damaging Het
Hk3 A T 13: 55,006,575 S773T probably benign Het
Hnrnpc A G 14: 52,075,395 S221P probably damaging Het
Ifna9 T C 4: 88,591,983 T135A probably benign Het
Igfn1 C T 1: 135,968,308 G1507R probably benign Het
Kank3 A G 17: 33,818,375 T218A probably benign Het
Kcp G T 6: 29,498,965 R337S possibly damaging Het
Krt74 A T 15: 101,756,674 noncoding transcript Het
Lrp1 A T 10: 127,556,921 D2758E probably damaging Het
Ly75 T C 2: 60,314,234 E1295G probably damaging Het
Mccc1 C A 3: 35,978,933 W354L probably damaging Het
Mmp1a C T 9: 7,465,656 T198M probably benign Het
Mtmr2 C T 9: 13,803,501 T519I probably damaging Het
Nbea A G 3: 55,645,986 S2632P possibly damaging Het
Nbn T A 4: 15,970,903 D295E probably benign Het
Ndufb8 T C 19: 44,550,381 Y167C probably damaging Het
Nisch A G 14: 31,191,521 probably benign Het
Notch3 C T 17: 32,156,119 G407D probably damaging Het
Nucb1 A G 7: 45,498,864 F175S probably damaging Het
Olfr355 T G 2: 36,927,334 Y260S probably damaging Het
Olfr804 G A 10: 129,705,291 V138M probably benign Het
Olfr834 T A 9: 18,988,710 C241S probably damaging Het
Olfr907 T G 9: 38,499,572 I301R unknown Het
Pip5k1c T C 10: 81,312,515 V425A probably damaging Het
Pnisr T A 4: 21,873,857 probably benign Het
Prkag1 A G 15: 98,815,895 V18A probably damaging Het
Rad50 T C 11: 53,668,223 N1063S probably benign Het
Rnf170 C T 8: 26,129,143 H132Y probably damaging Het
Rnf213 A G 11: 119,437,672 D1977G probably benign Het
Sema3a G A 5: 13,557,125 probably null Het
Setx T A 2: 29,126,905 C7S probably damaging Het
Slc23a2 A G 2: 132,065,464 I417T probably damaging Het
Spink6 T G 18: 44,071,521 F18C unknown Het
Sptbn1 T C 11: 30,120,783 Q1538R possibly damaging Het
Strn3 A G 12: 51,652,826 Y188H probably damaging Het
Tecpr1 C A 5: 144,197,944 K1040N probably benign Het
Tll1 T A 8: 64,017,686 Y901F probably benign Het
Tmem81 C T 1: 132,507,897 A147V probably benign Het
Tnpo3 T C 6: 29,565,759 D532G probably benign Het
Vmn2r19 T A 6: 123,336,452 I827N probably benign Het
Wdr35 A G 12: 9,020,000 K857R probably benign Het
Wdr60 T C 12: 116,229,610 Q574R probably benign Het
Zfp110 A G 7: 12,848,642 T406A probably benign Het
Zfp52 T C 17: 21,561,822 L644P possibly damaging Het
Zfp605 G A 5: 110,127,585 V190I probably benign Het
Zfp964 A G 8: 69,664,083 probably null Het
Zmynd8 A G 2: 165,807,885 S779P probably benign Het
Zswim5 T A 4: 116,986,895 N1043K probably damaging Het
Other mutations in Atf7ip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00844:Atf7ip APN 6 136560681 missense probably benign 0.00
IGL01483:Atf7ip APN 6 136587459 missense probably damaging 1.00
IGL02313:Atf7ip APN 6 136606720 missense probably damaging 0.99
IGL02319:Atf7ip APN 6 136593118 missense probably benign 0.01
IGL02547:Atf7ip APN 6 136603276 splice site probably benign
IGL02869:Atf7ip APN 6 136606579 missense probably damaging 0.99
IGL02895:Atf7ip APN 6 136560688 missense probably damaging 0.99
IGL02967:Atf7ip APN 6 136606727 missense probably damaging 0.98
IGL03026:Atf7ip APN 6 136605382 missense possibly damaging 0.79
R0024:Atf7ip UTSW 6 136599820 splice site probably benign
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0045:Atf7ip UTSW 6 136559816 missense probably damaging 1.00
R0325:Atf7ip UTSW 6 136560989 missense possibly damaging 0.86
R0331:Atf7ip UTSW 6 136561163 missense possibly damaging 0.94
R0415:Atf7ip UTSW 6 136560012 missense possibly damaging 0.92
R0490:Atf7ip UTSW 6 136609192 unclassified probably benign
R0526:Atf7ip UTSW 6 136559805 missense probably damaging 1.00
R1503:Atf7ip UTSW 6 136606867 missense probably damaging 0.96
R1793:Atf7ip UTSW 6 136609219 unclassified probably benign
R1822:Atf7ip UTSW 6 136587260 missense probably benign 0.11
R1873:Atf7ip UTSW 6 136559888 missense probably damaging 1.00
R1937:Atf7ip UTSW 6 136560780 missense probably benign 0.41
R2059:Atf7ip UTSW 6 136609348 unclassified probably benign
R2134:Atf7ip UTSW 6 136605487 missense possibly damaging 0.80
R2679:Atf7ip UTSW 6 136566651 missense possibly damaging 0.62
R3430:Atf7ip UTSW 6 136575324 unclassified probably benign
R3755:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3756:Atf7ip UTSW 6 136560817 missense probably benign 0.01
R3890:Atf7ip UTSW 6 136587045 missense possibly damaging 0.48
R4190:Atf7ip UTSW 6 136587501 missense probably damaging 1.00
R4494:Atf7ip UTSW 6 136563749 splice site probably null
R4588:Atf7ip UTSW 6 136599694 missense probably benign
R4618:Atf7ip UTSW 6 136565106 missense probably damaging 1.00
R4705:Atf7ip UTSW 6 136561194 missense probably damaging 1.00
R4838:Atf7ip UTSW 6 136596491 missense probably benign 0.06
R4922:Atf7ip UTSW 6 136560041 missense possibly damaging 0.91
R4956:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4957:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R4958:Atf7ip UTSW 6 136606810 missense probably damaging 1.00
R5000:Atf7ip UTSW 6 136582428 missense probably damaging 1.00
R5001:Atf7ip UTSW 6 136561388 missense probably damaging 0.99
R5075:Atf7ip UTSW 6 136560234 missense probably benign
R5279:Atf7ip UTSW 6 136603379 nonsense probably null
R5445:Atf7ip UTSW 6 136587257 missense probably damaging 1.00
R5844:Atf7ip UTSW 6 136606814 missense probably damaging 1.00
R5850:Atf7ip UTSW 6 136566787 critical splice donor site probably null
R5891:Atf7ip UTSW 6 136559977 missense possibly damaging 0.64
R5987:Atf7ip UTSW 6 136571502 missense probably damaging 1.00
R6168:Atf7ip UTSW 6 136559819 missense probably damaging 1.00
R6726:Atf7ip UTSW 6 136582391 missense probably damaging 1.00
R6880:Atf7ip UTSW 6 136561040 missense probably damaging 1.00
R6924:Atf7ip UTSW 6 136559757 splice site probably null
R7075:Atf7ip UTSW 6 136596515 critical splice donor site probably null
R7308:Atf7ip UTSW 6 136565089 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTGTAAGCAGTGGCCTGATCTCCC -3'
(R):5'- GCAAGTGTGCTGTTCCATATGTCCC -3'

Sequencing Primer
(F):5'- GGGAAAATGCACATGACCTTC -3'
(R):5'- TACGTCATATAGAGCAGTACATACC -3'
Posted On2014-05-09