Incidental Mutation 'R1664:Ppip5k1'
ID186987
Institutional Source Beutler Lab
Gene Symbol Ppip5k1
Ensembl Gene ENSMUSG00000033526
Gene Namediphosphoinositol pentakisphosphate kinase 1
SynonymsHisppd2a, B430315C20Rik
MMRRC Submission 039700-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.354) question?
Stock #R1664 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121310561-121355396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121337182 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 784 (V784A)
Ref Sequence ENSEMBL: ENSMUSP00000106258 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052029] [ENSMUST00000110625] [ENSMUST00000110626] [ENSMUST00000110627] [ENSMUST00000110628] [ENSMUST00000155568]
Predicted Effect probably benign
Transcript: ENSMUST00000052029
AA Change: V784A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000057632
Gene: ENSMUSG00000033526
AA Change: V784A

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.8e-110 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110625
AA Change: V784A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106255
Gene: ENSMUSG00000033526
AA Change: V784A

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110626
AA Change: V784A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106256
Gene: ENSMUSG00000033526
AA Change: V784A

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 1.1e-135 PFAM
low complexity region 1163 1181 N/A INTRINSIC
coiled coil region 1402 1430 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110627
AA Change: V784A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106257
Gene: ENSMUSG00000033526
AA Change: V784A

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 906 8.5e-110 PFAM
low complexity region 1142 1160 N/A INTRINSIC
coiled coil region 1381 1409 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110628
AA Change: V784A

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000106258
Gene: ENSMUSG00000033526
AA Change: V784A

DomainStartEndE-ValueType
low complexity region 35 48 N/A INTRINSIC
PDB:3T99|A 50 377 N/A PDB
Pfam:His_Phos_2 390 886 3.9e-101 PFAM
low complexity region 1143 1161 N/A INTRINSIC
coiled coil region 1382 1410 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127255
SMART Domains Protein: ENSMUSP00000118597
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 54 6.7e-9 PFAM
low complexity region 142 162 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132114
SMART Domains Protein: ENSMUSP00000117948
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 117 1.4e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132613
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142364
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150081
Predicted Effect probably benign
Transcript: ENSMUST00000155568
SMART Domains Protein: ENSMUSP00000116335
Gene: ENSMUSG00000033526

DomainStartEndE-ValueType
Pfam:His_Phos_2 1 107 8.6e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dual functional inositol kinase. The encoded enzyme converts inositol hexakisphosphate to diphosphoinositol pentakisphosphate and diphosphoinositol pentakisphosphate to bis-diphosphoinositol tetrakisphosphate. This protein may be important for intracellular signaling pathways. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 15.[provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,518 I437F probably damaging Het
4930596D02Rik T A 14: 35,811,815 T45S probably benign Het
Ackr1 A G 1: 173,332,866 F29L probably benign Het
Adgrf2 T A 17: 42,714,414 S60C possibly damaging Het
Alpk2 A G 18: 65,349,873 C355R probably damaging Het
Ankmy1 A C 1: 92,885,191 D465E probably benign Het
Ankrd27 T A 7: 35,607,126 D310E probably damaging Het
Ap3d1 G A 10: 80,717,737 Q559* probably null Het
C4b T C 17: 34,732,978 T1298A probably damaging Het
Casr T A 16: 36,509,965 K336* probably null Het
Ccdc116 A T 16: 17,142,628 D108E probably benign Het
Ccr7 A T 11: 99,145,691 I135N possibly damaging Het
Cd96 A G 16: 46,118,001 Y34H possibly damaging Het
Cdan1 T A 2: 120,720,506 D1135V probably damaging Het
Cecr2 C A 6: 120,762,026 T1210K probably damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd9 T G 8: 91,022,790 probably null Het
Cntnap5c G T 17: 58,293,990 W776L probably benign Het
Col24a1 G A 3: 145,389,600 probably null Het
Cpa2 G T 6: 30,554,315 M311I probably damaging Het
Cpz A G 5: 35,506,743 F483L probably damaging Het
Ddx19a A C 8: 110,989,498 V90G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw7 A G 3: 84,969,171 D213G possibly damaging Het
Fgd2 T C 17: 29,369,299 F362L probably damaging Het
Fryl A G 5: 73,059,435 Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 R90G probably benign Het
Gm10073 T C 8: 106,573,232 E40G probably damaging Het
Gm8251 T A 1: 44,059,227 I904F possibly damaging Het
Grhl3 T C 4: 135,552,550 I398V probably benign Het
Grip2 T A 6: 91,765,252 H899L probably damaging Het
Grk2 T C 19: 4,287,240 K644E possibly damaging Het
Iars A T 13: 49,711,775 T576S probably damaging Het
Kif26b G A 1: 178,932,139 V2084M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc69 G A 4: 14,775,079 T63M probably damaging Het
Lrrn4 A T 2: 132,869,966 C646S probably damaging Het
Mtf2 C T 5: 108,104,476 T457M probably damaging Het
Ncln A T 10: 81,487,721 C531S probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr110 C T 17: 37,499,425 T258M possibly damaging Het
Olfr251 A T 9: 38,378,252 M124L possibly damaging Het
Olfr761 T C 17: 37,952,893 I44V probably benign Het
Otogl A G 10: 107,806,576 V1331A probably benign Het
Palb2 A G 7: 122,124,392 probably benign Het
Pcdh20 T C 14: 88,468,322 E514G possibly damaging Het
Pclaf A G 9: 65,890,448 N7S probably benign Het
Pdrg1 C T 2: 153,015,328 probably benign Het
Pik3r6 T A 11: 68,536,106 D464E probably benign Het
Pkp3 A G 7: 141,087,647 N454D probably damaging Het
Plekha7 C A 7: 116,135,034 probably null Het
Ppp1r36 T A 12: 76,436,254 D205E possibly damaging Het
Prss35 A T 9: 86,755,647 T157S probably benign Het
Ptprn2 T C 12: 117,161,709 L621P probably damaging Het
Rasgrp3 A G 17: 75,524,177 K524R probably damaging Het
Rasgrp4 T A 7: 29,140,263 H133Q probably benign Het
Reln A T 5: 21,929,086 Y2615N probably damaging Het
Rpf1 T A 3: 146,512,148 T204S probably benign Het
Scgb2b3 T A 7: 31,359,039 *113L probably null Het
Scn5a A C 9: 119,521,177 L877R possibly damaging Het
Sh3pxd2a A T 19: 47,268,382 D632E probably benign Het
Slc39a10 T C 1: 46,826,109 H522R probably damaging Het
Spink2 A T 5: 77,207,008 C19S probably damaging Het
Spsb4 A G 9: 96,996,213 L19P possibly damaging Het
St7l T C 3: 104,870,898 V117A probably damaging Het
Stac2 C T 11: 98,042,594 S174N probably damaging Het
Sult4a1 A G 15: 84,086,617 Y196H probably benign Het
Tex2 C T 11: 106,567,782 probably benign Het
Tprgl A T 4: 154,159,405 V98D possibly damaging Het
Ttn G A 2: 76,718,025 H31978Y probably damaging Het
Ttn T C 2: 76,828,509 probably benign Het
Tyk2 C A 9: 21,120,353 R447L probably damaging Het
Ucn3 T C 13: 3,941,634 Y6C possibly damaging Het
Urb1 A T 16: 90,788,082 probably null Het
Vmn2r94 G C 17: 18,244,144 A628G probably damaging Het
Wdr95 C A 5: 149,595,287 T389K probably damaging Het
Wrn A T 8: 33,280,766 probably null Het
Xab2 T A 8: 3,619,068 probably null Het
Zfp458 A T 13: 67,258,080 N95K possibly damaging Het
Zfp672 T C 11: 58,317,312 H61R probably damaging Het
Zfp942 C T 17: 21,928,439 G403E possibly damaging Het
Other mutations in Ppip5k1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00909:Ppip5k1 APN 2 121347358 missense probably damaging 1.00
IGL01154:Ppip5k1 APN 2 121343179 missense probably damaging 1.00
IGL01341:Ppip5k1 APN 2 121343210 nonsense probably null
IGL01704:Ppip5k1 APN 2 121312074 missense possibly damaging 0.74
IGL01949:Ppip5k1 APN 2 121337860 missense probably benign
IGL02101:Ppip5k1 APN 2 121331608 missense possibly damaging 0.84
IGL02499:Ppip5k1 APN 2 121331553 splice site probably null
IGL02701:Ppip5k1 APN 2 121316649 splice site probably null
IGL03188:Ppip5k1 APN 2 121326846 unclassified probably benign
R0363:Ppip5k1 UTSW 2 121347355 missense probably damaging 1.00
R1315:Ppip5k1 UTSW 2 121312005 missense probably benign 0.13
R1753:Ppip5k1 UTSW 2 121342631 missense probably damaging 1.00
R1759:Ppip5k1 UTSW 2 121350586 missense probably benign 0.32
R1763:Ppip5k1 UTSW 2 121348547 missense probably damaging 1.00
R2033:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R2037:Ppip5k1 UTSW 2 121343193 missense probably damaging 1.00
R2066:Ppip5k1 UTSW 2 121342871 unclassified probably benign
R2103:Ppip5k1 UTSW 2 121321653 unclassified probably null
R3414:Ppip5k1 UTSW 2 121327661 missense probably damaging 0.97
R4022:Ppip5k1 UTSW 2 121337627 missense probably damaging 1.00
R4569:Ppip5k1 UTSW 2 121343563 missense possibly damaging 0.69
R4783:Ppip5k1 UTSW 2 121340848 missense probably benign 0.12
R4843:Ppip5k1 UTSW 2 121326887 missense probably damaging 1.00
R4981:Ppip5k1 UTSW 2 121312390 missense probably damaging 1.00
R5353:Ppip5k1 UTSW 2 121311720 missense probably benign 0.00
R5493:Ppip5k1 UTSW 2 121336772 missense probably damaging 1.00
R5654:Ppip5k1 UTSW 2 121316676 missense probably benign 0.00
R5835:Ppip5k1 UTSW 2 121337899 missense probably benign 0.01
R5987:Ppip5k1 UTSW 2 121350491 nonsense probably null
R6076:Ppip5k1 UTSW 2 121337110 missense probably null 1.00
R6088:Ppip5k1 UTSW 2 121337463 missense probably benign 0.29
R6276:Ppip5k1 UTSW 2 121323203 unclassified probably benign
R6555:Ppip5k1 UTSW 2 121337612 missense probably damaging 0.99
R6878:Ppip5k1 UTSW 2 121311936 missense probably benign 0.00
X0020:Ppip5k1 UTSW 2 121341655 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAAGGAGGCTGCTTACATCGAGAAG -3'
(R):5'- GGCTCTGGGTGAACATCAAGACTG -3'

Sequencing Primer
(F):5'- AGTGAACATGACTCTCACTGG -3'
(R):5'- CATCAAGACTGACTGAGGAAATGTC -3'
Posted On2014-05-09