Incidental Mutation 'R1664:Pik3r6'
ID187042
Institutional Source Beutler Lab
Gene Symbol Pik3r6
Ensembl Gene ENSMUSG00000046207
Gene Namephosphoinositide-3-kinase regulatory subunit 5
Synonyms
MMRRC Submission 039700-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.046) question?
Stock #R1664 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location68503019-68552698 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68536106 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 464 (D464E)
Ref Sequence ENSEMBL: ENSMUSP00000099673 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060441] [ENSMUST00000102613]
Predicted Effect probably benign
Transcript: ENSMUST00000060441
AA Change: D468E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052522
Gene: ENSMUSG00000046207
AA Change: D468E

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 7 306 7.4e-28 PFAM
low complexity region 310 324 N/A INTRINSIC
Pfam:PI3K_1B_p101 394 755 1.2e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102613
AA Change: D464E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099673
Gene: ENSMUSG00000046207
AA Change: D464E

DomainStartEndE-ValueType
Pfam:PI3K_1B_p101 3 335 1.8e-111 PFAM
Pfam:PI3K_1B_p101 332 752 1.6e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153671
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 11. The protein binds to both the catalytic subunit and to G beta-gamma, and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small reductions in lymphocyte and granulocyte and a slight increase in neutrophils. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,518 I437F probably damaging Het
4930596D02Rik T A 14: 35,811,815 T45S probably benign Het
Ackr1 A G 1: 173,332,866 F29L probably benign Het
Adgrf2 T A 17: 42,714,414 S60C possibly damaging Het
Alpk2 A G 18: 65,349,873 C355R probably damaging Het
Ankmy1 A C 1: 92,885,191 D465E probably benign Het
Ankrd27 T A 7: 35,607,126 D310E probably damaging Het
Ap3d1 G A 10: 80,717,737 Q559* probably null Het
C4b T C 17: 34,732,978 T1298A probably damaging Het
Casr T A 16: 36,509,965 K336* probably null Het
Ccdc116 A T 16: 17,142,628 D108E probably benign Het
Ccr7 A T 11: 99,145,691 I135N possibly damaging Het
Cd96 A G 16: 46,118,001 Y34H possibly damaging Het
Cdan1 T A 2: 120,720,506 D1135V probably damaging Het
Cecr2 C A 6: 120,762,026 T1210K probably damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd9 T G 8: 91,022,790 probably null Het
Cntnap5c G T 17: 58,293,990 W776L probably benign Het
Col24a1 G A 3: 145,389,600 probably null Het
Cpa2 G T 6: 30,554,315 M311I probably damaging Het
Cpz A G 5: 35,506,743 F483L probably damaging Het
Ddx19a A C 8: 110,989,498 V90G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw7 A G 3: 84,969,171 D213G possibly damaging Het
Fgd2 T C 17: 29,369,299 F362L probably damaging Het
Fryl A G 5: 73,059,435 Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 R90G probably benign Het
Gm10073 T C 8: 106,573,232 E40G probably damaging Het
Gm8251 T A 1: 44,059,227 I904F possibly damaging Het
Grhl3 T C 4: 135,552,550 I398V probably benign Het
Grip2 T A 6: 91,765,252 H899L probably damaging Het
Grk2 T C 19: 4,287,240 K644E possibly damaging Het
Iars A T 13: 49,711,775 T576S probably damaging Het
Kif26b G A 1: 178,932,139 V2084M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc69 G A 4: 14,775,079 T63M probably damaging Het
Lrrn4 A T 2: 132,869,966 C646S probably damaging Het
Mtf2 C T 5: 108,104,476 T457M probably damaging Het
Ncln A T 10: 81,487,721 C531S probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr110 C T 17: 37,499,425 T258M possibly damaging Het
Olfr251 A T 9: 38,378,252 M124L possibly damaging Het
Olfr761 T C 17: 37,952,893 I44V probably benign Het
Otogl A G 10: 107,806,576 V1331A probably benign Het
Palb2 A G 7: 122,124,392 probably benign Het
Pcdh20 T C 14: 88,468,322 E514G possibly damaging Het
Pclaf A G 9: 65,890,448 N7S probably benign Het
Pdrg1 C T 2: 153,015,328 probably benign Het
Pkp3 A G 7: 141,087,647 N454D probably damaging Het
Plekha7 C A 7: 116,135,034 probably null Het
Ppip5k1 A G 2: 121,337,182 V784A probably benign Het
Ppp1r36 T A 12: 76,436,254 D205E possibly damaging Het
Prss35 A T 9: 86,755,647 T157S probably benign Het
Ptprn2 T C 12: 117,161,709 L621P probably damaging Het
Rasgrp3 A G 17: 75,524,177 K524R probably damaging Het
Rasgrp4 T A 7: 29,140,263 H133Q probably benign Het
Reln A T 5: 21,929,086 Y2615N probably damaging Het
Rpf1 T A 3: 146,512,148 T204S probably benign Het
Scgb2b3 T A 7: 31,359,039 *113L probably null Het
Scn5a A C 9: 119,521,177 L877R possibly damaging Het
Sh3pxd2a A T 19: 47,268,382 D632E probably benign Het
Slc39a10 T C 1: 46,826,109 H522R probably damaging Het
Spink2 A T 5: 77,207,008 C19S probably damaging Het
Spsb4 A G 9: 96,996,213 L19P possibly damaging Het
St7l T C 3: 104,870,898 V117A probably damaging Het
Stac2 C T 11: 98,042,594 S174N probably damaging Het
Sult4a1 A G 15: 84,086,617 Y196H probably benign Het
Tex2 C T 11: 106,567,782 probably benign Het
Tprgl A T 4: 154,159,405 V98D possibly damaging Het
Ttn G A 2: 76,718,025 H31978Y probably damaging Het
Ttn T C 2: 76,828,509 probably benign Het
Tyk2 C A 9: 21,120,353 R447L probably damaging Het
Ucn3 T C 13: 3,941,634 Y6C possibly damaging Het
Urb1 A T 16: 90,788,082 probably null Het
Vmn2r94 G C 17: 18,244,144 A628G probably damaging Het
Wdr95 C A 5: 149,595,287 T389K probably damaging Het
Wrn A T 8: 33,280,766 probably null Het
Xab2 T A 8: 3,619,068 probably null Het
Zfp458 A T 13: 67,258,080 N95K possibly damaging Het
Zfp672 T C 11: 58,317,312 H61R probably damaging Het
Zfp942 C T 17: 21,928,439 G403E possibly damaging Het
Other mutations in Pik3r6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Pik3r6 APN 11 68534251 missense probably damaging 0.98
IGL00913:Pik3r6 APN 11 68551321 missense probably damaging 1.00
IGL00984:Pik3r6 APN 11 68533619 missense probably benign 0.39
IGL01110:Pik3r6 APN 11 68528826 critical splice donor site probably null
IGL01116:Pik3r6 APN 11 68531450 missense probably benign 0.01
IGL02839:Pik3r6 APN 11 68526412 missense probably damaging 1.00
PIT4142001:Pik3r6 UTSW 11 68527105 missense probably damaging 1.00
R0044:Pik3r6 UTSW 11 68544750 missense probably benign 0.02
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0062:Pik3r6 UTSW 11 68528809 missense probably damaging 1.00
R0266:Pik3r6 UTSW 11 68526408 nonsense probably null
R0454:Pik3r6 UTSW 11 68528782 missense possibly damaging 0.88
R0906:Pik3r6 UTSW 11 68536101 splice site probably benign
R1119:Pik3r6 UTSW 11 68545872 missense probably benign 0.05
R1440:Pik3r6 UTSW 11 68531445 missense possibly damaging 0.91
R1831:Pik3r6 UTSW 11 68544034 missense probably benign 0.26
R2144:Pik3r6 UTSW 11 68543611 nonsense probably null
R4013:Pik3r6 UTSW 11 68533521 missense possibly damaging 0.85
R4754:Pik3r6 UTSW 11 68544775 missense probably damaging 1.00
R4770:Pik3r6 UTSW 11 68529894 missense probably damaging 1.00
R4860:Pik3r6 UTSW 11 68544053 splice site probably benign
R4974:Pik3r6 UTSW 11 68539945 missense probably damaging 1.00
R5033:Pik3r6 UTSW 11 68533468 nonsense probably null
R5787:Pik3r6 UTSW 11 68539927 missense possibly damaging 0.54
R5918:Pik3r6 UTSW 11 68525671 nonsense probably null
R6164:Pik3r6 UTSW 11 68551973 missense probably benign 0.00
R6192:Pik3r6 UTSW 11 68543629 missense probably damaging 1.00
R6440:Pik3r6 UTSW 11 68533696 missense probably benign 0.09
W0251:Pik3r6 UTSW 11 68533871 missense probably benign 0.01
Z1088:Pik3r6 UTSW 11 68525602 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCGTTTAGAGGTCAACAGTGTC -3'
(R):5'- GGCTGATTCTAAGGTCAAGGGTCAC -3'

Sequencing Primer
(F):5'- TTAGTGTCAGACAAGTGGCCC -3'
(R):5'- ccctcccccttttcctctc -3'
Posted On2014-05-09