Incidental Mutation 'R1664:Rasgrp3'
ID187070
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene NameRAS, guanyl releasing protein 3
SynonymsLOC240168
MMRRC Submission 039700-MU
Accession Numbers

Ncbi RefSeq: NM_207246.4, NM_001166493.1; MGI:3028579

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1664 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location75435905-75529043 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75524177 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 524 (K524R)
Ref Sequence ENSEMBL: ENSMUSP00000129393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
Predicted Effect probably damaging
Transcript: ENSMUST00000095204
AA Change: K524R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042
AA Change: K524R

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000164192
AA Change: K524R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042
AA Change: K524R

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype Strain: 3625862; 3525522
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T A 17: 33,066,518 I437F probably damaging Het
4930596D02Rik T A 14: 35,811,815 T45S probably benign Het
Ackr1 A G 1: 173,332,866 F29L probably benign Het
Adgrf2 T A 17: 42,714,414 S60C possibly damaging Het
Alpk2 A G 18: 65,349,873 C355R probably damaging Het
Ankmy1 A C 1: 92,885,191 D465E probably benign Het
Ankrd27 T A 7: 35,607,126 D310E probably damaging Het
Ap3d1 G A 10: 80,717,737 Q559* probably null Het
C4b T C 17: 34,732,978 T1298A probably damaging Het
Casr T A 16: 36,509,965 K336* probably null Het
Ccdc116 A T 16: 17,142,628 D108E probably benign Het
Ccr7 A T 11: 99,145,691 I135N possibly damaging Het
Cd96 A G 16: 46,118,001 Y34H possibly damaging Het
Cdan1 T A 2: 120,720,506 D1135V probably damaging Het
Cecr2 C A 6: 120,762,026 T1210K probably damaging Het
Cep152 C A 2: 125,566,254 A1390S probably benign Het
Chd9 T G 8: 91,022,790 probably null Het
Cntnap5c G T 17: 58,293,990 W776L probably benign Het
Col24a1 G A 3: 145,389,600 probably null Het
Cpa2 G T 6: 30,554,315 M311I probably damaging Het
Cpz A G 5: 35,506,743 F483L probably damaging Het
Ddx19a A C 8: 110,989,498 V90G probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fbxw7 A G 3: 84,969,171 D213G possibly damaging Het
Fgd2 T C 17: 29,369,299 F362L probably damaging Het
Fryl A G 5: 73,059,435 Y2171H probably damaging Het
Gba2 T C 4: 43,578,080 R90G probably benign Het
Gm10073 T C 8: 106,573,232 E40G probably damaging Het
Gm8251 T A 1: 44,059,227 I904F possibly damaging Het
Grhl3 T C 4: 135,552,550 I398V probably benign Het
Grip2 T A 6: 91,765,252 H899L probably damaging Het
Grk2 T C 19: 4,287,240 K644E possibly damaging Het
Iars A T 13: 49,711,775 T576S probably damaging Het
Kif26b G A 1: 178,932,139 V2084M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrrc69 G A 4: 14,775,079 T63M probably damaging Het
Lrrn4 A T 2: 132,869,966 C646S probably damaging Het
Mtf2 C T 5: 108,104,476 T457M probably damaging Het
Ncln A T 10: 81,487,721 C531S probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr110 C T 17: 37,499,425 T258M possibly damaging Het
Olfr251 A T 9: 38,378,252 M124L possibly damaging Het
Olfr761 T C 17: 37,952,893 I44V probably benign Het
Otogl A G 10: 107,806,576 V1331A probably benign Het
Palb2 A G 7: 122,124,392 probably benign Het
Pcdh20 T C 14: 88,468,322 E514G possibly damaging Het
Pclaf A G 9: 65,890,448 N7S probably benign Het
Pdrg1 C T 2: 153,015,328 probably benign Het
Pik3r6 T A 11: 68,536,106 D464E probably benign Het
Pkp3 A G 7: 141,087,647 N454D probably damaging Het
Plekha7 C A 7: 116,135,034 probably null Het
Ppip5k1 A G 2: 121,337,182 V784A probably benign Het
Ppp1r36 T A 12: 76,436,254 D205E possibly damaging Het
Prss35 A T 9: 86,755,647 T157S probably benign Het
Ptprn2 T C 12: 117,161,709 L621P probably damaging Het
Rasgrp4 T A 7: 29,140,263 H133Q probably benign Het
Reln A T 5: 21,929,086 Y2615N probably damaging Het
Rpf1 T A 3: 146,512,148 T204S probably benign Het
Scgb2b3 T A 7: 31,359,039 *113L probably null Het
Scn5a A C 9: 119,521,177 L877R possibly damaging Het
Sh3pxd2a A T 19: 47,268,382 D632E probably benign Het
Slc39a10 T C 1: 46,826,109 H522R probably damaging Het
Spink2 A T 5: 77,207,008 C19S probably damaging Het
Spsb4 A G 9: 96,996,213 L19P possibly damaging Het
St7l T C 3: 104,870,898 V117A probably damaging Het
Stac2 C T 11: 98,042,594 S174N probably damaging Het
Sult4a1 A G 15: 84,086,617 Y196H probably benign Het
Tex2 C T 11: 106,567,782 probably benign Het
Tprgl A T 4: 154,159,405 V98D possibly damaging Het
Ttn G A 2: 76,718,025 H31978Y probably damaging Het
Ttn T C 2: 76,828,509 probably benign Het
Tyk2 C A 9: 21,120,353 R447L probably damaging Het
Ucn3 T C 13: 3,941,634 Y6C possibly damaging Het
Urb1 A T 16: 90,788,082 probably null Het
Vmn2r94 G C 17: 18,244,144 A628G probably damaging Het
Wdr95 C A 5: 149,595,287 T389K probably damaging Het
Wrn A T 8: 33,280,766 probably null Het
Xab2 T A 8: 3,619,068 probably null Het
Zfp458 A T 13: 67,258,080 N95K possibly damaging Het
Zfp672 T C 11: 58,317,312 H61R probably damaging Het
Zfp942 C T 17: 21,928,439 G403E possibly damaging Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75516373 missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75525102 missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75496417 missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75497070 missense probably benign 0.00
Aster UTSW 17 75509827 splice site probably null
aston UTSW 17 75500758 critical splice donor site probably null
centre UTSW 17 75500734 missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75500713 missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75498461 missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75509827 splice site probably null
R1182:Rasgrp3 UTSW 17 75503190 missense probably benign 0.01
R1412:Rasgrp3 UTSW 17 75509827 splice site probably null
R1572:Rasgrp3 UTSW 17 75500734 missense possibly damaging 0.50
R2094:Rasgrp3 UTSW 17 75503141 missense probably damaging 1.00
R2111:Rasgrp3 UTSW 17 75500758 critical splice donor site probably null
R3026:Rasgrp3 UTSW 17 75524921 missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75496968 missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75511980 missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75500673 missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75498448 missense possibly damaging 0.64
R4791:Rasgrp3 UTSW 17 75500173 missense probably benign 0.37
R4901:Rasgrp3 UTSW 17 75514116 nonsense probably null
R4927:Rasgrp3 UTSW 17 75516355 missense probably benign 0.00
R5410:Rasgrp3 UTSW 17 75497047 missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75503375 missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75525018 missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75516359 missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75524945 missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75503147 missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75494209 missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75503115 missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75503246 missense probably damaging 1.00
X0011:Rasgrp3 UTSW 17 75525166 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGAGCAGCTCCATCCTGTTTGTG -3'
(R):5'- AACCGTGTGTCTGACTCAGCTTCC -3'

Sequencing Primer
(F):5'- TGTGAGCCACCAGTTGTTG -3'
(R):5'- GTCTGACTCAGCTTCCAGAGTG -3'
Posted On2014-05-09