Incidental Mutation 'R1665:Mfn1'
ID187089
Institutional Source Beutler Lab
Gene Symbol Mfn1
Ensembl Gene ENSMUSG00000027668
Gene Namemitofusin 1
Synonyms6330416C07Rik, HR2, D3Ertd265e, 2310002F04Rik
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location32529465-32579239 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 32534322 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 66 (V66G)
Ref Sequence ENSEMBL: ENSMUSP00000117411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091257] [ENSMUST00000118286] [ENSMUST00000137565] [ENSMUST00000147350]
Predicted Effect probably benign
Transcript: ENSMUST00000091257
AA Change: V66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000088801
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.7e-6 PFAM
Pfam:Dynamin_N 78 238 3.9e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 575 735 1.2e-78 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118286
AA Change: V66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113251
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 1.2e-6 PFAM
Pfam:Dynamin_N 78 238 5e-24 PFAM
low complexity region 315 326 N/A INTRINSIC
low complexity region 394 405 N/A INTRINSIC
Pfam:Fzo_mitofusin 567 737 6.3e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125182
Predicted Effect probably benign
Transcript: ENSMUST00000137565
AA Change: V66G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117411
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 188 3.8e-6 PFAM
Pfam:Dynamin_N 78 189 5.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147350
AA Change: V66G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116380
Gene: ENSMUSG00000027668
AA Change: V66G

DomainStartEndE-ValueType
Pfam:MMR_HSR1 77 237 3.6e-8 PFAM
Pfam:Dynamin_N 78 238 1.5e-25 PFAM
Meta Mutation Damage Score 0.122 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a mediator of mitochondrial fusion. This protein and mitofusin 2 are homologs of the Drosophila protein fuzzy onion (Fzo). They are mitochondrial membrane proteins that interact with each other to facilitate mitochondrial targeting. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene die in mid gestation. Structural and functional abnormalities of mitochondria are reported. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Wdr59 A G 8: 111,479,362 F553S probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Mfn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Mfn1 APN 3 32542836 missense probably damaging 1.00
IGL01687:Mfn1 APN 3 32563366 splice site probably benign
IGL02743:Mfn1 APN 3 32574290 missense probably benign 0.10
PIT4520001:Mfn1 UTSW 3 32561546 missense probably benign
R0039:Mfn1 UTSW 3 32538267 splice site probably benign
R0571:Mfn1 UTSW 3 32561472 missense probably damaging 1.00
R0920:Mfn1 UTSW 3 32534236 critical splice acceptor site probably null
R1661:Mfn1 UTSW 3 32534322 missense probably benign 0.00
R2153:Mfn1 UTSW 3 32542826 missense probably damaging 1.00
R2156:Mfn1 UTSW 3 32534251 missense possibly damaging 0.60
R2260:Mfn1 UTSW 3 32563426 nonsense probably null
R2420:Mfn1 UTSW 3 32569515 missense probably benign 0.21
R3864:Mfn1 UTSW 3 32563092 missense possibly damaging 0.89
R4079:Mfn1 UTSW 3 32542849 missense probably damaging 1.00
R4162:Mfn1 UTSW 3 32562998 splice site probably benign
R4897:Mfn1 UTSW 3 32546562 intron probably benign
R5115:Mfn1 UTSW 3 32564307 critical splice donor site probably null
R5276:Mfn1 UTSW 3 32564205 missense probably benign 0.39
R5590:Mfn1 UTSW 3 32563847 missense probably benign 0.00
R5629:Mfn1 UTSW 3 32561510 missense possibly damaging 0.83
R6110:Mfn1 UTSW 3 32563024 missense probably benign 0.01
R6114:Mfn1 UTSW 3 32563836 missense probably damaging 1.00
R6560:Mfn1 UTSW 3 32569516 missense probably damaging 0.96
R6891:Mfn1 UTSW 3 32577103 missense possibly damaging 0.49
R7053:Mfn1 UTSW 3 32531965 missense probably benign 0.00
R7071:Mfn1 UTSW 3 32568395 missense probably benign 0.00
R7182:Mfn1 UTSW 3 32564220 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGGATAATCCTTTCAGAGGGC -3'
(R):5'- CTTGACCAGGCAGTAGTGACACAG -3'

Sequencing Primer
(F):5'- GGATAATCCTTTCAGAGGGCATTTAC -3'
(R):5'- gaaggaaggaaggaaggaagg -3'
Posted On2014-05-09