Incidental Mutation 'R1665:Wdr59'
ID187115
Institutional Source Beutler Lab
Gene Symbol Wdr59
Ensembl Gene ENSMUSG00000031959
Gene NameWD repeat domain 59
Synonyms5430401O09Rik
MMRRC Submission 039701-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.952) question?
Stock #R1665 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111448797-111522092 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111479362 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 553 (F553S)
Ref Sequence ENSEMBL: ENSMUSP00000148397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034437] [ENSMUST00000038193] [ENSMUST00000211981]
Predicted Effect probably damaging
Transcript: ENSMUST00000034437
AA Change: F553S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034437
Gene: ENSMUSG00000031959
AA Change: F553S

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 620 632 N/A INTRINSIC
low complexity region 802 813 N/A INTRINSIC
Blast:RING 941 980 3e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000038193
AA Change: F553S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043671
Gene: ENSMUSG00000031959
AA Change: F553S

DomainStartEndE-ValueType
WD40 41 91 1.37e2 SMART
WD40 94 134 9.52e-6 SMART
WD40 138 176 4.46e-1 SMART
WD40 180 220 2.59e-7 SMART
WD40 271 315 8.59e-1 SMART
RWD 393 494 4.13e-14 SMART
low complexity region 803 814 N/A INTRINSIC
Pfam:Zn_ribbon_17 937 992 2e-14 PFAM
Pfam:zinc_ribbon_16 949 990 1.6e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000211981
AA Change: F553S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.286 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 100% (87/87)
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 G A 17: 24,377,842 G423E probably damaging Het
Acox3 A T 5: 35,603,027 H429L probably damaging Het
Afg1l T A 10: 42,426,577 K142N probably damaging Het
Aldh1a7 T C 19: 20,727,461 I18V probably benign Het
Angel2 T C 1: 190,937,467 Y115H probably damaging Het
Bsg T G 10: 79,711,518 N261K probably damaging Het
C2cd2l A T 9: 44,316,775 V83E probably benign Het
Caml C A 13: 55,631,971 L286I probably benign Het
Ccdc125 A G 13: 100,693,573 I284V probably benign Het
Ces2a G A 8: 104,737,555 probably benign Het
Cfap61 T C 2: 146,035,319 probably null Het
Creg2 C T 1: 39,623,204 W253* probably null Het
Csmd3 T C 15: 47,696,789 T2293A probably damaging Het
Cttnbp2 A T 6: 18,434,983 I292K probably benign Het
Dab2ip T A 2: 35,720,278 M770K probably damaging Het
Dct T A 14: 118,034,251 D389V probably damaging Het
Dnah17 A T 11: 118,121,495 probably benign Het
Dnah6 T C 6: 73,124,778 E1921G probably benign Het
Ehmt1 A G 2: 24,877,464 S272P probably damaging Het
Ero1lb T C 13: 12,579,261 probably null Het
Fnip2 A G 3: 79,515,149 F108S probably benign Het
Foxb1 G A 9: 69,759,822 A142V probably damaging Het
Fras1 A T 5: 96,598,909 S613C probably damaging Het
Gm11639 A G 11: 104,721,114 K594R probably benign Het
Gm7276 C A 18: 77,185,570 probably benign Het
Gnb4 A C 3: 32,590,039 L152* probably null Het
H1fnt G T 15: 98,256,915 Q118K probably benign Het
Hdac7 A G 15: 97,806,525 L119P probably damaging Het
Hsd17b4 G A 18: 50,160,215 E274K probably benign Het
Htr4 T C 18: 62,412,234 I30T probably damaging Het
Ikzf2 T A 1: 69,538,814 Y512F probably damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Klhl22 C A 16: 17,776,488 D160E probably benign Het
Kpna6 T A 4: 129,657,471 R80S probably benign Het
Lclat1 A G 17: 73,188,004 E142G probably damaging Het
Lrig3 T C 10: 125,997,701 Y349H probably benign Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map1b T A 13: 99,431,929 N1428I unknown Het
Map3k19 T A 1: 127,817,656 T1354S possibly damaging Het
Med13l T A 5: 118,749,748 W1696R probably damaging Het
Mfn1 T G 3: 32,534,322 V66G probably benign Het
Mllt10 A T 2: 18,208,790 Q459L possibly damaging Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Muc15 C T 2: 110,733,898 Q260* probably null Het
Nfkb1 T C 3: 135,594,957 H616R probably damaging Het
Nr2c1 T A 10: 94,188,183 W417R probably damaging Het
Olfr1279 T C 2: 111,306,771 C189R probably damaging Het
Olfr1285 T C 2: 111,408,753 Y113H probably damaging Het
Olfr1480 A T 19: 13,529,838 H99L probably damaging Het
Olfr250 C T 9: 38,367,566 H7Y probably benign Het
Olfr541 G T 7: 140,704,794 C181F probably damaging Het
Olfr714 T C 7: 107,074,274 S149P probably damaging Het
Pde10a A G 17: 8,898,870 D26G probably damaging Het
Pi15 G T 1: 17,621,502 C176F probably damaging Het
Pou2f2 T A 7: 25,092,724 T569S possibly damaging Het
Prf1 A C 10: 61,302,887 E208A probably benign Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Rc3h1 T A 1: 160,959,423 V796E probably benign Het
Rgl1 T C 1: 152,533,575 Y503C probably damaging Het
Ripk3 T A 14: 55,786,351 H1L probably benign Het
Ryr1 C T 7: 29,036,078 D4064N probably damaging Het
Sec63 T A 10: 42,798,728 probably null Het
Slco1a4 T G 6: 141,839,577 M96L possibly damaging Het
Slit3 A T 11: 35,234,906 R137S possibly damaging Het
Smad1 T C 8: 79,372,029 E52G probably damaging Het
Srd5a2 A T 17: 74,021,481 W201R probably damaging Het
Steap1 A T 5: 5,736,498 L313Q probably damaging Het
Syt2 C A 1: 134,747,620 A403D probably damaging Het
Tax1bp1 T A 6: 52,736,912 S225R probably benign Het
Thap3 C T 4: 151,985,704 V78M probably damaging Het
Thoc5 A G 11: 4,919,792 K446R probably benign Het
Timmdc1 A C 16: 38,510,717 probably null Het
Tm6sf2 G T 8: 70,078,930 probably benign Het
Tmem126b G T 7: 90,475,971 A2E probably damaging Het
Trim9 T A 12: 70,255,113 R584W probably damaging Het
Ttn C A 2: 76,830,856 probably benign Het
Vmn1r25 A T 6: 57,978,461 I281N probably damaging Het
Zc3h4 A G 7: 16,429,580 M575V unknown Het
Zfp53 A G 17: 21,509,504 T600A probably damaging Het
Zic5 A G 14: 122,459,527 S559P unknown Het
Other mutations in Wdr59
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Wdr59 APN 8 111458736 missense probably damaging 0.98
IGL01330:Wdr59 APN 8 111481933 missense possibly damaging 0.87
IGL01413:Wdr59 APN 8 111501074 missense probably benign 0.23
IGL02306:Wdr59 APN 8 111492733 missense probably damaging 1.00
IGL03027:Wdr59 APN 8 111462192 missense probably damaging 1.00
IGL03057:Wdr59 APN 8 111476118 missense probably damaging 1.00
IGL03204:Wdr59 APN 8 111485370 missense probably benign 0.05
R0056:Wdr59 UTSW 8 111480607 splice site probably benign
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0096:Wdr59 UTSW 8 111504373 missense probably damaging 1.00
R0440:Wdr59 UTSW 8 111480540 small deletion probably benign
R0452:Wdr59 UTSW 8 111521972 missense possibly damaging 0.87
R0472:Wdr59 UTSW 8 111486997 critical splice acceptor site probably null
R0501:Wdr59 UTSW 8 111458947 missense possibly damaging 0.90
R0526:Wdr59 UTSW 8 111480540 small deletion probably benign
R0534:Wdr59 UTSW 8 111480540 small deletion probably benign
R0601:Wdr59 UTSW 8 111480540 small deletion probably benign
R1144:Wdr59 UTSW 8 111486944 missense probably benign 0.09
R1415:Wdr59 UTSW 8 111498596 missense probably damaging 1.00
R1571:Wdr59 UTSW 8 111451050 missense probably damaging 0.98
R1661:Wdr59 UTSW 8 111479362 missense probably damaging 1.00
R1839:Wdr59 UTSW 8 111485340 missense probably benign
R1856:Wdr59 UTSW 8 111476181 missense probably damaging 1.00
R1872:Wdr59 UTSW 8 111459017 missense probably damaging 1.00
R1921:Wdr59 UTSW 8 111486950 nonsense probably null
R1965:Wdr59 UTSW 8 111451077 missense probably damaging 1.00
R1966:Wdr59 UTSW 8 111450903 missense possibly damaging 0.92
R1977:Wdr59 UTSW 8 111458638 missense probably benign 0.00
R2019:Wdr59 UTSW 8 111466793 missense probably damaging 1.00
R4245:Wdr59 UTSW 8 111490364 missense possibly damaging 0.63
R4471:Wdr59 UTSW 8 111466787 critical splice donor site probably null
R4820:Wdr59 UTSW 8 111480814 missense probably benign 0.19
R5198:Wdr59 UTSW 8 111481988 missense probably benign 0.00
R5540:Wdr59 UTSW 8 111485184 missense possibly damaging 0.84
R5571:Wdr59 UTSW 8 111465831 missense probably damaging 1.00
R6166:Wdr59 UTSW 8 111472661 missense probably damaging 1.00
R6732:Wdr59 UTSW 8 111501052 missense probably damaging 1.00
R6767:Wdr59 UTSW 8 111476101 missense probably damaging 1.00
R6823:Wdr59 UTSW 8 111459040 missense possibly damaging 0.95
R6841:Wdr59 UTSW 8 111496880 missense probably damaging 1.00
R6888:Wdr59 UTSW 8 111451043 missense probably benign 0.00
R6974:Wdr59 UTSW 8 111460788 missense possibly damaging 0.86
R6982:Wdr59 UTSW 8 111460813 missense probably benign 0.00
X0026:Wdr59 UTSW 8 111479340 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TGGTCTAATACAGAACCTGACACCCTC -3'
(R):5'- GCCAATCCCCAGTACCACCGAATTTA -3'

Sequencing Primer
(F):5'- caagagaaaggacaggagagag -3'
(R):5'- ggctcatgccttaatcccag -3'
Posted On2014-05-09