Incidental Mutation 'R1667:Dusp10'
ID187255
Institutional Source Beutler Lab
Gene Symbol Dusp10
Ensembl Gene ENSMUSG00000039384
Gene Namedual specificity phosphatase 10
SynonymsMKP5, 2610306G15Rik, MKP-5
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.660) question?
Stock #R1667 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location184013302-184075636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 184036858 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 7 (D7G)
Ref Sequence ENSEMBL: ENSMUSP00000045838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048655] [ENSMUST00000050306] [ENSMUST00000139839]
Predicted Effect probably damaging
Transcript: ENSMUST00000048655
AA Change: D7G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045838
Gene: ENSMUSG00000039384
AA Change: D7G

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
RHOD 159 283 1.71e-11 SMART
DSPc 322 462 1.43e-54 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000050306
SMART Domains Protein: ENSMUSP00000055787
Gene: ENSMUSG00000044854

DomainStartEndE-ValueType
SCOP:d1howa_ 12 46 7e-3 SMART
low complexity region 81 115 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000139839
AA Change: D7G

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121433
Gene: ENSMUSG00000039384
AA Change: D7G

DomainStartEndE-ValueType
low complexity region 33 59 N/A INTRINSIC
low complexity region 92 111 N/A INTRINSIC
low complexity region 124 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193919
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dual specificity protein phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the MAP kinase superfamily, which is associated with cellular proliferation and differentiation. Different members of this family of dual specificity phosphatases show distinct substrate specificities for MAP kinases, different tissue distribution and subcellular localization, and different modes of expression induction by extracellular stimuli. This gene product binds to and inactivates p38 and SAPK/JNK. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele display alterations in both innate and adaptive immune responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Anks1b T C 10: 90,511,184 probably null Het
Ascl1 T C 10: 87,492,793 N99S probably benign Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Atp2c1 A T 9: 105,432,797 L566Q probably null Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dhx30 G T 9: 110,085,445 L995I possibly damaging Het
Dhx30 G C 9: 110,085,446 N957K possibly damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Nup93 T A 8: 94,292,687 V47E possibly damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Dusp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Dusp10 APN 1 184069131 missense probably benign 0.00
IGL01094:Dusp10 APN 1 184037500 unclassified probably null
IGL01380:Dusp10 APN 1 184069014 missense possibly damaging 0.93
FR4449:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4548:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4737:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
FR4976:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
LCD18:Dusp10 UTSW 1 184037056 missense probably damaging 1.00
R0369:Dusp10 UTSW 1 184069056 missense probably damaging 1.00
R0433:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R0464:Dusp10 UTSW 1 184069076 missense probably benign 0.01
R1112:Dusp10 UTSW 1 184036900 missense probably damaging 0.98
R1474:Dusp10 UTSW 1 184037448 unclassified probably null
R1719:Dusp10 UTSW 1 184037225 missense probably benign 0.22
R1899:Dusp10 UTSW 1 184069180 missense possibly damaging 0.64
R5238:Dusp10 UTSW 1 184037013 missense possibly damaging 0.94
R5277:Dusp10 UTSW 1 184037007 missense possibly damaging 0.94
R5742:Dusp10 UTSW 1 184037656 splice site probably null
R5948:Dusp10 UTSW 1 184068876 missense probably benign
R6890:Dusp10 UTSW 1 184069196 missense probably damaging 1.00
R6969:Dusp10 UTSW 1 184068888 missense probably damaging 1.00
R7007:Dusp10 UTSW 1 184037217 missense probably benign 0.22
R7033:Dusp10 UTSW 1 184037605 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GACTTAGCATCAGAATGGATGGGGC -3'
(R):5'- GAGGGCATATACGTCAGATTCGCAG -3'

Sequencing Primer
(F):5'- AGGTATGCATCCTCTCTGAACAG -3'
(R):5'- TATACGTCAGATTCGCAGCCTTG -3'
Posted On2014-05-09