Incidental Mutation 'R1667:Dhx30'
ID187298
Institutional Source Beutler Lab
Gene Symbol Dhx30
Ensembl Gene ENSMUSG00000032480
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 30
SynonymsDdx30, 2810477H02Rik, C130058C04Rik
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1667 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location110084320-110117830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 110085446 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 957 (N957K)
Ref Sequence ENSEMBL: ENSMUSP00000143616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035055] [ENSMUST00000062368] [ENSMUST00000111991] [ENSMUST00000163979] [ENSMUST00000164930] [ENSMUST00000165596] [ENSMUST00000165876] [ENSMUST00000196171] [ENSMUST00000197928] [ENSMUST00000198425] [ENSMUST00000198511] [ENSMUST00000199161] [ENSMUST00000199461] [ENSMUST00000199498] [ENSMUST00000199529] [ENSMUST00000199548] [ENSMUST00000199693] [ENSMUST00000200066]
Predicted Effect probably benign
Transcript: ENSMUST00000035055
SMART Domains Protein: ENSMUSP00000035055
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.96e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.96e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 903 926 2e-12 PFAM
Pfam:Tubulin-binding 965 995 4.9e-18 PFAM
Pfam:Tubulin-binding 996 1026 7.4e-18 PFAM
Pfam:Tubulin-binding 1027 1058 4.4e-15 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062368
AA Change: N994K

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000062622
Gene: ENSMUSG00000032480
AA Change: N994K

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 48 64 N/A INTRINSIC
internal_repeat_1 76 123 2.53e-5 PROSPERO
low complexity region 217 228 N/A INTRINSIC
internal_repeat_1 268 314 2.53e-5 PROSPERO
low complexity region 321 342 N/A INTRINSIC
DEXDc 461 650 9.66e-29 SMART
low complexity region 679 689 N/A INTRINSIC
HELICc 711 816 1.63e-17 SMART
HA2 879 969 5.16e-22 SMART
Pfam:OB_NTP_bind 984 1134 5.7e-9 PFAM
low complexity region 1200 1208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111991
AA Change: N965K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000107622
Gene: ENSMUSG00000032480
AA Change: N965K

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163979
SMART Domains Protein: ENSMUSP00000129362
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164930
SMART Domains Protein: ENSMUSP00000131285
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 6e-16 PFAM
Pfam:Tubulin-binding 774 804 4.5e-19 PFAM
Pfam:Tubulin-binding 805 835 2.3e-18 PFAM
Pfam:Tubulin-binding 836 867 1.6e-11 PFAM
low complexity region 902 917 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165596
AA Change: N988K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129174
Gene: ENSMUSG00000032480
AA Change: N988K

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165876
SMART Domains Protein: ENSMUSP00000132662
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 254 265 N/A INTRINSIC
internal_repeat_1 266 379 4.95e-7 PROSPERO
low complexity region 401 420 N/A INTRINSIC
internal_repeat_1 439 550 4.95e-7 PROSPERO
low complexity region 659 674 N/A INTRINSIC
low complexity region 720 742 N/A INTRINSIC
low complexity region 760 775 N/A INTRINSIC
low complexity region 879 889 N/A INTRINSIC
Pfam:Tubulin-binding 896 926 8.5e-16 PFAM
Pfam:Tubulin-binding 965 995 6.4e-19 PFAM
Pfam:Tubulin-binding 996 1026 3.3e-18 PFAM
Pfam:Tubulin-binding 1027 1058 2.3e-11 PFAM
low complexity region 1093 1108 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196171
AA Change: N957K

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143616
Gene: ENSMUSG00000032480
AA Change: N957K

DomainStartEndE-ValueType
internal_repeat_1 39 86 5.84e-5 PROSPERO
low complexity region 180 191 N/A INTRINSIC
internal_repeat_1 231 277 5.84e-5 PROSPERO
low complexity region 284 305 N/A INTRINSIC
DEXDc 424 613 9.66e-29 SMART
low complexity region 642 652 N/A INTRINSIC
HELICc 674 779 1.63e-17 SMART
HA2 842 932 5.16e-22 SMART
Pfam:OB_NTP_bind 947 1097 2.8e-9 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196914
Predicted Effect probably benign
Transcript: ENSMUST00000197928
AA Change: N965K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142549
Gene: ENSMUSG00000032480
AA Change: N965K

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198026
Predicted Effect probably benign
Transcript: ENSMUST00000198425
AA Change: N988K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142659
Gene: ENSMUSG00000032480
AA Change: N988K

DomainStartEndE-ValueType
internal_repeat_1 70 117 6.77e-5 PROSPERO
low complexity region 211 222 N/A INTRINSIC
internal_repeat_1 262 308 6.77e-5 PROSPERO
low complexity region 315 336 N/A INTRINSIC
DEXDc 455 644 9.66e-29 SMART
low complexity region 673 683 N/A INTRINSIC
HELICc 705 810 1.63e-17 SMART
HA2 873 963 5.16e-22 SMART
Pfam:OB_NTP_bind 975 1129 1.8e-7 PFAM
low complexity region 1194 1202 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000198511
SMART Domains Protein: ENSMUSP00000142558
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:Tubulin-binding 24 54 7.3e-14 PFAM
Pfam:Tubulin-binding 55 85 5.3e-17 PFAM
Pfam:Tubulin-binding 86 116 2.8e-16 PFAM
Pfam:Tubulin-binding 117 148 1.9e-9 PFAM
low complexity region 183 198 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199161
SMART Domains Protein: ENSMUSP00000143205
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
Pfam:Tubulin-binding 16 46 6.7e-14 PFAM
Pfam:Tubulin-binding 47 77 4.9e-17 PFAM
Pfam:Tubulin-binding 78 108 2.5e-16 PFAM
Pfam:Tubulin-binding 109 140 1.7e-9 PFAM
low complexity region 176 191 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199332
Predicted Effect probably benign
Transcript: ENSMUST00000199461
SMART Domains Protein: ENSMUSP00000143296
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1e-13 PFAM
Pfam:Tubulin-binding 147 177 3.8e-16 PFAM
Pfam:Tubulin-binding 178 209 2.6e-9 PFAM
low complexity region 244 259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199498
SMART Domains Protein: ENSMUSP00000142439
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 9 17 N/A INTRINSIC
low complexity region 324 341 N/A INTRINSIC
low complexity region 365 376 N/A INTRINSIC
low complexity region 506 521 N/A INTRINSIC
low complexity region 567 589 N/A INTRINSIC
low complexity region 607 622 N/A INTRINSIC
low complexity region 726 736 N/A INTRINSIC
Pfam:Tubulin-binding 743 773 5.8e-16 PFAM
Pfam:Tubulin-binding 774 804 2.2e-18 PFAM
Pfam:Tubulin-binding 805 836 1.6e-11 PFAM
low complexity region 871 886 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199529
AA Change: N965K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142489
Gene: ENSMUSG00000032480
AA Change: N965K

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199548
SMART Domains Protein: ENSMUSP00000143408
Gene: ENSMUSG00000032479

DomainStartEndE-ValueType
low complexity region 99 109 N/A INTRINSIC
Pfam:Tubulin-binding 116 146 1.1e-13 PFAM
Pfam:Tubulin-binding 147 177 7.9e-17 PFAM
Pfam:Tubulin-binding 178 208 4.1e-16 PFAM
Pfam:Tubulin-binding 209 240 2.8e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199693
Predicted Effect probably benign
Transcript: ENSMUST00000199985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200029
Predicted Effect probably benign
Transcript: ENSMUST00000200066
AA Change: N965K

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143371
Gene: ENSMUSG00000032480
AA Change: N965K

DomainStartEndE-ValueType
internal_repeat_1 47 94 6.21e-5 PROSPERO
low complexity region 188 199 N/A INTRINSIC
internal_repeat_1 239 285 6.21e-5 PROSPERO
low complexity region 292 313 N/A INTRINSIC
DEXDc 432 621 9.66e-29 SMART
low complexity region 650 660 N/A INTRINSIC
HELICc 682 787 1.63e-17 SMART
HA2 850 940 5.16e-22 SMART
Pfam:OB_NTP_bind 952 1106 2.1e-7 PFAM
low complexity region 1171 1179 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000200480
Predicted Effect unknown
Transcript: ENSMUST00000200593
AA Change: N23K
Meta Mutation Damage Score 0.078 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The family member encoded by this gene is a mitochondrial nucleoid protein that associates with mitochondrial DNA. It has also been identified as a component of a transcriptional repressor complex that functions in retinal development, and it is required to optimize the function of the zinc-finger antiviral protein. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Feb 2013]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit complete embryonic lethality associated with embryonic growth retardation, failure of initiation of embryo turning, and absence of organized somites and neural tube formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Anks1b T C 10: 90,511,184 probably null Het
Ascl1 T C 10: 87,492,793 N99S probably benign Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Atp2c1 A T 9: 105,432,797 L566Q probably null Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
Dusp10 A G 1: 184,036,858 D7G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Nup93 T A 8: 94,292,687 V47E possibly damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Dhx30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01343:Dhx30 APN 9 110086245 missense probably benign 0.01
IGL01800:Dhx30 APN 9 110085513 missense possibly damaging 0.92
IGL02403:Dhx30 APN 9 110091519 missense probably damaging 1.00
IGL02869:Dhx30 APN 9 110097183 missense probably damaging 1.00
IGL03177:Dhx30 APN 9 110088010 missense possibly damaging 0.75
R0092:Dhx30 UTSW 9 110085010 missense possibly damaging 0.94
R0601:Dhx30 UTSW 9 110086714 unclassified probably null
R1667:Dhx30 UTSW 9 110085445 missense possibly damaging 0.91
R1670:Dhx30 UTSW 9 110085273 missense possibly damaging 0.86
R1728:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1729:Dhx30 UTSW 9 110098751 missense probably damaging 0.98
R1795:Dhx30 UTSW 9 110107983 splice site probably null
R1854:Dhx30 UTSW 9 110088672 missense probably damaging 1.00
R2191:Dhx30 UTSW 9 110086118 critical splice donor site probably null
R2219:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2220:Dhx30 UTSW 9 110087635 missense probably damaging 1.00
R2267:Dhx30 UTSW 9 110087034 missense probably damaging 1.00
R2374:Dhx30 UTSW 9 110091564 missense probably damaging 0.98
R2568:Dhx30 UTSW 9 110097195 missense probably damaging 0.99
R2881:Dhx30 UTSW 9 110098845 nonsense probably null
R4022:Dhx30 UTSW 9 110084397 missense possibly damaging 0.90
R4052:Dhx30 UTSW 9 110100821 missense possibly damaging 0.46
R4695:Dhx30 UTSW 9 110085288 missense probably damaging 0.98
R4728:Dhx30 UTSW 9 110087650 missense probably damaging 1.00
R4892:Dhx30 UTSW 9 110085856 unclassified probably null
R4911:Dhx30 UTSW 9 110100924 missense probably damaging 1.00
R4937:Dhx30 UTSW 9 110085961 missense probably damaging 1.00
R5135:Dhx30 UTSW 9 110098795 missense probably damaging 1.00
R5359:Dhx30 UTSW 9 110093135 missense probably damaging 0.99
R5462:Dhx30 UTSW 9 110100974 missense probably damaging 0.97
R5504:Dhx30 UTSW 9 110085210 missense probably benign 0.08
R5797:Dhx30 UTSW 9 110098820 missense probably damaging 0.99
R5860:Dhx30 UTSW 9 110084577 missense probably damaging 0.98
R6041:Dhx30 UTSW 9 110084598 missense probably benign 0.09
R6132:Dhx30 UTSW 9 110085779 missense probably damaging 1.00
R6158:Dhx30 UTSW 9 110087030 missense probably damaging 1.00
R6475:Dhx30 UTSW 9 110085052 missense possibly damaging 0.91
R6818:Dhx30 UTSW 9 110088031 missense probably damaging 1.00
R6984:Dhx30 UTSW 9 110091417 critical splice donor site probably null
X0027:Dhx30 UTSW 9 110084434 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CTCTGAGAACTGCTTGATGAGCCC -3'
(R):5'- TTAGACCCAGTGCTTCCTATAGCCC -3'

Sequencing Primer
(F):5'- CCTGGGGAGGCAAAGTGC -3'
(R):5'- AGTGCTTCCTATAGCCCTCTTG -3'
Posted On2014-05-09