Incidental Mutation 'R1667:Anks1b'
ID187300
Institutional Source Beutler Lab
Gene Symbol Anks1b
Ensembl Gene ENSMUSG00000058589
Gene Nameankyrin repeat and sterile alpha motif domain containing 1B
SynonymsC030032C09Rik, AIDA-1b, LOC380650, Gm10937, E530015N03Rik
MMRRC Submission 039703-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1667 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location89873509-90973300 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 90511184 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099368] [ENSMUST00000099368] [ENSMUST00000182907] [ENSMUST00000182936] [ENSMUST00000183156]
Predicted Effect probably null
Transcript: ENSMUST00000099368
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000099368
SMART Domains Protein: ENSMUSP00000096968
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 931 4.44e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000182907
SMART Domains Protein: ENSMUSP00000138614
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 45 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182936
SMART Domains Protein: ENSMUSP00000138209
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 5.03e2 SMART
low complexity region 464 479 N/A INTRINSIC
low complexity region 517 543 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183156
SMART Domains Protein: ENSMUSP00000138539
Gene: ENSMUSG00000058589

DomainStartEndE-ValueType
low complexity region 21 46 N/A INTRINSIC
ANK 58 87 1.88e-5 SMART
ANK 91 123 3.13e-2 SMART
ANK 127 156 6.92e-4 SMART
ANK 160 189 3.08e-1 SMART
ANK 193 222 1.43e-5 SMART
ANK 225 254 4.75e-2 SMART
low complexity region 498 513 N/A INTRINSIC
low complexity region 551 577 N/A INTRINSIC
low complexity region 659 670 N/A INTRINSIC
SAM 806 875 2.06e-19 SMART
SAM 880 948 5.66e-17 SMART
low complexity region 968 983 N/A INTRINSIC
PTB 1056 1194 2.94e-38 SMART
Meta Mutation Damage Score 0.488 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency 99% (76/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is predominantly expressed in brain and testis. This protein interacts with amyloid beta protein precursor (AbetaPP) and may have a role in normal brain development, and in the pathogenesis of Alzheimer's disease. Expression of this gene has been shown to be elevated in patients with pre-B cell acute lymphocytic leukemia associated with t(1;19) translocation. Alternatively spliced transcript variants encoding different isoforms (some with different subcellular localization, PMID:15004329) have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a conditional allele activated in neurons alters hippocampal synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgra1 G A 7: 139,845,648 A26T possibly damaging Het
Adgrg3 T A 8: 95,033,373 Y73* probably null Het
Alk A T 17: 71,911,567 V761E probably damaging Het
Ankrd13a T C 5: 114,786,733 V93A possibly damaging Het
Ascl1 T C 10: 87,492,793 N99S probably benign Het
Atm A T 9: 53,500,932 L972Q probably damaging Het
Atp2c1 A T 9: 105,432,797 L566Q probably null Het
Bank1 T A 3: 136,093,296 Y629F probably damaging Het
Bod1l G T 5: 41,816,775 L2399I probably benign Het
Bub1b G A 2: 118,641,189 G1010D probably benign Het
Ces1b G A 8: 93,056,904 H563Y possibly damaging Het
Cfap70 T C 14: 20,404,157 E853G probably benign Het
Cfh T C 1: 140,105,523 E779G probably benign Het
Cox7c A G 13: 86,045,884 S7P probably benign Het
Cyp2c67 A G 19: 39,643,590 probably null Het
Dhx30 G T 9: 110,085,445 L995I possibly damaging Het
Dhx30 G C 9: 110,085,446 N957K possibly damaging Het
Dsc3 T C 18: 19,991,560 T36A possibly damaging Het
Dstyk A G 1: 132,456,919 D717G probably damaging Het
Dusp10 A G 1: 184,036,858 D7G probably damaging Het
E230001N04Rik T G 17: 28,523,961 noncoding transcript Het
Ece2 T C 16: 20,637,838 S330P possibly damaging Het
Fam172a T A 13: 77,759,516 M1K probably null Het
Frmd5 ATAGTGGAATTGTTCAAACTC ATAGTGGAATTGTTCAAACTCTAGTGGAATTGTTCAAACTC 2: 121,548,730 probably null Het
Gata3 T C 2: 9,877,549 H14R possibly damaging Het
Ggta1 T A 2: 35,414,283 I75F possibly damaging Het
Hcn1 A T 13: 117,603,073 I124F unknown Het
Herpud1 A C 8: 94,389,366 D53A probably damaging Het
Inhba T A 13: 16,026,624 L257Q possibly damaging Het
Itga10 C T 3: 96,651,738 probably benign Het
Jmy T A 13: 93,498,370 S313C probably damaging Het
Lpo G A 11: 87,807,241 probably benign Het
Lsg1 T C 16: 30,571,352 E315G probably damaging Het
Lsm14a T A 7: 34,365,654 T167S possibly damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Map3k2 T C 18: 32,203,792 probably benign Het
Mapk12 A T 15: 89,140,141 M81K probably damaging Het
Matn2 T A 15: 34,378,732 C305S probably damaging Het
Mgam T C 6: 40,677,044 Y844H possibly damaging Het
Mgat5b A G 11: 116,947,377 R281G probably benign Het
Mon1b T G 8: 113,641,957 C497G probably damaging Het
Mybbp1a A T 11: 72,445,217 H452L probably benign Het
Mybl2 A G 2: 163,075,696 T41A probably damaging Het
Ncoa5 A G 2: 165,001,703 V540A probably damaging Het
Nup93 T A 8: 94,292,687 V47E possibly damaging Het
Olfr1052 A G 2: 86,298,736 M307V probably null Het
Olfr17 A T 7: 107,097,770 M102L probably benign Het
Orc6 T A 8: 85,305,285 C100S possibly damaging Het
Otogl G T 10: 107,813,965 Y1176* probably null Het
Patj A T 4: 98,413,027 D183V probably damaging Het
Pik3r3 A G 4: 116,222,317 T4A probably damaging Het
Pla2g4d G A 2: 120,270,150 probably benign Het
Pla2r1 A G 2: 60,420,257 I1407T probably benign Het
Pramef12 A T 4: 144,393,036 C320* probably null Het
Prex2 A T 1: 11,186,757 H1231L probably benign Het
Prkca A G 11: 107,983,946 V390A probably damaging Het
Psmd13 T A 7: 140,890,609 W255R probably damaging Het
Rec8 T A 14: 55,618,796 N37K probably damaging Het
Rnf207 C T 4: 152,313,215 E361K probably benign Het
Serpina3f T A 12: 104,217,440 L187Q probably damaging Het
Skint11 A T 4: 114,194,781 T109S probably damaging Het
Slc7a8 A G 14: 54,724,849 S443P probably damaging Het
Slc8b1 T A 5: 120,521,082 F197Y probably benign Het
Sox2 T C 3: 34,650,419 Y2H probably damaging Het
Speg T A 1: 75,410,549 probably benign Het
Tlr3 T C 8: 45,400,837 N149D probably benign Het
Trim60 A C 8: 65,001,464 D44E probably benign Het
Ugt1a7c A G 1: 88,095,935 Y272C probably damaging Het
Vmn1r4 T A 6: 56,956,753 Y81N probably damaging Het
Vmn2r73 A T 7: 85,857,681 C808S probably benign Het
Ythdf3 T C 3: 16,204,892 I412T possibly damaging Het
Zfp672 T C 11: 58,316,095 T467A possibly damaging Het
Zfp985 A T 4: 147,583,950 Q425L possibly damaging Het
Other mutations in Anks1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01669:Anks1b APN 10 90897238 splice site probably benign
IGL01890:Anks1b APN 10 90644527 missense probably benign 0.15
IGL01966:Anks1b APN 10 90895132 missense probably damaging 1.00
IGL02176:Anks1b APN 10 90042668 missense probably damaging 0.99
IGL02205:Anks1b APN 10 90071094 missense probably benign 0.00
IGL02465:Anks1b APN 10 90163265 nonsense probably null
IGL02534:Anks1b APN 10 90895117 missense probably benign 0.45
IGL02554:Anks1b APN 10 90921378 missense probably damaging 1.00
IGL02820:Anks1b APN 10 90077059 missense possibly damaging 0.93
IGL03164:Anks1b APN 10 90042692 missense probably damaging 1.00
R0096:Anks1b UTSW 10 90074062 missense possibly damaging 0.90
R0482:Anks1b UTSW 10 90359195 missense probably benign 0.00
R0542:Anks1b UTSW 10 90073967 splice site probably benign
R0848:Anks1b UTSW 10 90071125 missense probably damaging 0.99
R1056:Anks1b UTSW 10 90921429 splice site probably null
R1398:Anks1b UTSW 10 90050029 missense probably damaging 1.00
R1446:Anks1b UTSW 10 90511073 missense probably benign 0.00
R1548:Anks1b UTSW 10 90049985 missense possibly damaging 0.79
R1551:Anks1b UTSW 10 90076981 missense probably benign 0.00
R1607:Anks1b UTSW 10 90042548 missense probably damaging 1.00
R1701:Anks1b UTSW 10 90049954 missense probably damaging 1.00
R1843:Anks1b UTSW 10 90512889 critical splice donor site probably null
R1899:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R1957:Anks1b UTSW 10 90049930 missense probably damaging 1.00
R2036:Anks1b UTSW 10 90969853 missense probably damaging 0.99
R2279:Anks1b UTSW 10 90050096 missense probably damaging 1.00
R2280:Anks1b UTSW 10 90966302 missense probably damaging 1.00
R2937:Anks1b UTSW 10 90077066 missense probably damaging 1.00
R3739:Anks1b UTSW 10 90033216 missense probably damaging 1.00
R4061:Anks1b UTSW 10 90307622 missense probably damaging 0.98
R4459:Anks1b UTSW 10 90510844 missense probably damaging 1.00
R4479:Anks1b UTSW 10 90049892 missense probably damaging 1.00
R4510:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4511:Anks1b UTSW 10 90510790 missense probably benign 0.01
R4780:Anks1b UTSW 10 89873732 missense probably damaging 1.00
R4785:Anks1b UTSW 10 90914750 missense probably null 0.88
R4790:Anks1b UTSW 10 90163275 missense probably damaging 0.99
R5012:Anks1b UTSW 10 90359137 missense probably benign 0.06
R5400:Anks1b UTSW 10 90512824 missense probably damaging 1.00
R5586:Anks1b UTSW 10 90077064 missense probably damaging 0.98
R5687:Anks1b UTSW 10 90914711 missense probably benign 0.03
R5899:Anks1b UTSW 10 90923517 splice site probably null
R5917:Anks1b UTSW 10 90576941 intron probably benign
R5999:Anks1b UTSW 10 90359048 missense probably damaging 1.00
R6080:Anks1b UTSW 10 90966349 nonsense probably null
R6216:Anks1b UTSW 10 90260756 missense probably damaging 1.00
R6265:Anks1b UTSW 10 90941500 missense probably damaging 1.00
R6298:Anks1b UTSW 10 90680837 missense probably damaging 1.00
R6337:Anks1b UTSW 10 90921296 missense probably benign 0.27
R6522:Anks1b UTSW 10 90897327 intron probably benign
R6843:Anks1b UTSW 10 90948598 missense probably damaging 1.00
R6852:Anks1b UTSW 10 90260654 missense probably damaging 1.00
R6933:Anks1b UTSW 10 90069490 missense probably damaging 1.00
R7114:Anks1b UTSW 10 90307698 missense probably damaging 1.00
R7211:Anks1b UTSW 10 90511070 missense possibly damaging 0.94
R7241:Anks1b UTSW 10 90512837 missense probably damaging 1.00
R7264:Anks1b UTSW 10 90512870 missense probably benign 0.08
R7325:Anks1b UTSW 10 90941432 missense probably damaging 1.00
R7392:Anks1b UTSW 10 90680786 missense possibly damaging 0.47
X0064:Anks1b UTSW 10 90512845 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAACCATACCATCGTTGGCACAAG -3'
(R):5'- GTAGCAATGCGCTCATTTTCCCAC -3'

Sequencing Primer
(F):5'- TCGTTGGCACAAGAATGTCC -3'
(R):5'- TTATTAACAACGCCTACCCCTCC -3'
Posted On2014-05-09