Incidental Mutation 'R1669:Scn8a'
ID187487
Institutional Source Beutler Lab
Gene Symbol Scn8a
Ensembl Gene ENSMUSG00000023033
Gene Namesodium channel, voltage-gated, type VIII, alpha
Synonymsmnd2, C630029C19Rik, nmf58, NMF335, mnd-2, seal, motor end-plate disease, nur14, Nav1.6, med, ataxia 3, nmf2, nmf335, NaCh6
MMRRC Submission 039705-MU
Accession Numbers

Genbank: NM_001077499, NM_011323; MGI: 103169

Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R1669 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100869858-101045938 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 101011120 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 823 (V823G)
Ref Sequence ENSEMBL: ENSMUSP00000144013 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082209] [ENSMUST00000108908] [ENSMUST00000108909] [ENSMUST00000108910] [ENSMUST00000200963] [ENSMUST00000201518] [ENSMUST00000201549]
Predicted Effect probably damaging
Transcript: ENSMUST00000082209
AA Change: V823G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080842
Gene: ENSMUSG00000023033
AA Change: V823G

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108908
AA Change: V823G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104536
Gene: ENSMUSG00000023033
AA Change: V823G

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 1.9e-76 PFAM
low complexity region 367 378 N/A INTRINSIC
Pfam:Ion_trans 451 640 1.1e-47 PFAM
Pfam:Na_trans_assoc 655 872 1.9e-71 PFAM
Pfam:Ion_trans 898 1127 4.4e-59 PFAM
PDB:1BYY|A 1129 1181 7e-30 PDB
Pfam:Ion_trans 1220 1429 1.9e-51 PFAM
Pfam:PKD_channel 1281 1436 5.6e-7 PFAM
IQ 1558 1580 1.2e-4 SMART
low complexity region 1619 1638 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108909
AA Change: V833G

PolyPhen 2 Score 0.432 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000104537
Gene: ENSMUSG00000023033
AA Change: V833G

DomainStartEndE-ValueType
Pfam:Ion_trans 72 322 2.2e-76 PFAM
low complexity region 335 364 N/A INTRINSIC
Pfam:DUF3451 390 616 8.7e-70 PFAM
Pfam:Ion_trans 697 886 1.3e-47 PFAM
Pfam:Na_trans_assoc 901 1118 2.3e-71 PFAM
Pfam:Ion_trans 1144 1186 9.7e-10 PFAM
Pfam:Ion_trans 1182 1332 1.7e-31 PFAM
PDB:1BYY|A 1334 1386 2e-29 PDB
Pfam:Ion_trans 1425 1634 2.3e-51 PFAM
Pfam:PKD_channel 1486 1641 6.6e-7 PFAM
IQ 1763 1785 1.2e-4 SMART
low complexity region 1824 1843 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108910
AA Change: V823G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104538
Gene: ENSMUSG00000023033
AA Change: V823G

DomainStartEndE-ValueType
Pfam:Ion_trans 160 410 2.5e-76 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:DUF3451 478 704 9.6e-70 PFAM
Pfam:Ion_trans 785 974 1.4e-47 PFAM
Pfam:Na_trans_assoc 989 1206 2.5e-71 PFAM
Pfam:Ion_trans 1232 1461 5.7e-59 PFAM
PDB:1BYY|A 1463 1515 4e-29 PDB
Pfam:Ion_trans 1554 1763 2.5e-51 PFAM
Pfam:PKD_channel 1615 1770 7.1e-7 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000200963
AA Change: V823G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144371
Gene: ENSMUSG00000023033
AA Change: V823G

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 4.1e-80 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 2.5e-69 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 1.2e-55 PFAM
Pfam:Na_trans_assoc 989 1191 9.1e-57 PFAM
Pfam:Ion_trans 1195 1274 7.6e-16 PFAM
Pfam:Ion_trans 1270 1431 2.6e-33 PFAM
Pfam:Ion_trans 1478 1734 6.5e-55 PFAM
IQ 1851 1873 6e-7 SMART
low complexity region 1912 1931 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201246
Predicted Effect probably benign
Transcript: ENSMUST00000201518
SMART Domains Protein: ENSMUSP00000143879
Gene: ENSMUSG00000023033

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 8.8e-81 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 6.7e-70 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 804 5.3e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000201549
AA Change: V823G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144013
Gene: ENSMUSG00000023033
AA Change: V823G

DomainStartEndE-ValueType
Pfam:Ion_trans 131 422 7.4e-82 PFAM
low complexity region 423 452 N/A INTRINSIC
Pfam:Na_trans_cytopl 499 700 3.5e-72 PFAM
low complexity region 701 712 N/A INTRINSIC
Pfam:Ion_trans 750 985 2.2e-57 PFAM
Pfam:Na_trans_assoc 989 1191 2e-59 PFAM
Pfam:Ion_trans 1195 1472 6.2e-69 PFAM
Pfam:Ion_trans 1519 1775 1.2e-56 PFAM
IQ 1892 1914 1.2e-4 SMART
low complexity region 1953 1972 N/A INTRINSIC
Meta Mutation Damage Score 0.724 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.3%
Validation Efficiency 99% (85/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium channel alpha subunit gene family. The encoded protein forms the ion pore region of the voltage-gated sodium channel. This protein is essential for the rapid membrane depolarization that occurs during the formation of the action potential in excitable neurons. Mutations in this gene are associated with mental retardation, pancerebellar atrophy and ataxia. Alternate splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Spontaneous mutant homozygotes have ataxia, dystonia, muscular atrophy, progressive paralysis, Purkinje cell loss, in some cases severe head-tossing and for severe alleles, juvenile lethality. A mild, semidominant ENU allele causes deafness of variable penetrance and severity and mild tremor. [provided by MGI curators]
Allele List at MGI

 All alleles(22) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(6) Transgenic(1) Spontaneous(5) Chemically induced(8)

Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano10 A C 9: 122,257,183 L258R possibly damaging Het
Ap3d1 A G 10: 80,710,836 probably benign Het
Aplp2 G T 9: 31,167,733 probably benign Het
Arhgap11a T C 2: 113,841,912 D237G possibly damaging Het
Arhgef4 A T 1: 34,732,158 H1182L possibly damaging Het
Ash1l G A 3: 89,067,242 probably null Het
Bicdl1 C A 5: 115,656,016 V224L possibly damaging Het
Cacna1h C A 17: 25,383,471 V1422L probably damaging Het
Card10 T C 15: 78,793,953 E365G probably benign Het
Cd180 C T 13: 102,705,490 T348I probably damaging Het
Cds2 T A 2: 132,295,519 probably null Het
Chaf1a C A 17: 56,063,339 D601E probably benign Het
Coprs C T 8: 13,885,704 W12* probably null Het
Cpsf3 T A 12: 21,305,331 M424K probably damaging Het
Cxcl13 T A 5: 95,958,741 N57K probably damaging Het
Dact1 C T 12: 71,318,773 T776M probably damaging Het
Depdc1a A G 3: 159,522,924 K438E probably benign Het
Dopey2 T A 16: 93,769,660 S992T probably damaging Het
Dusp11 A T 6: 85,950,026 H202Q probably benign Het
Ezr T C 17: 6,739,313 E584G probably damaging Het
F830104G03Rik A G 3: 56,890,577 V6A unknown Het
Fam227a G A 15: 79,620,677 probably null Het
Gapvd1 T G 2: 34,730,682 probably null Het
Gm10267 T C 18: 44,157,300 R47G probably damaging Het
Gm13088 T G 4: 143,654,346 E369A possibly damaging Het
Gm6614 T A 6: 141,987,689 I457F probably benign Het
Hectd3 T A 4: 116,999,643 D462E probably damaging Het
Hfe A T 13: 23,706,127 L133* probably null Het
Hpcal4 T C 4: 123,189,076 F72L probably damaging Het
Itgb4 G A 11: 115,991,330 R825H probably benign Het
Kcnh8 T A 17: 52,893,968 Y477N probably damaging Het
Kctd1 T C 18: 15,062,460 N369D possibly damaging Het
Kdm1b C T 13: 47,068,548 R488C probably damaging Het
Kif1c C T 11: 70,728,397 L953F probably damaging Het
Klra8 A T 6: 130,115,629 C236* probably null Het
Lca5l T C 16: 96,159,808 R485G possibly damaging Het
Lrrc2 A G 9: 110,981,650 T363A probably damaging Het
Lsmem1 GTACATACATACATACATACATACATACA GTACATACATACATACATACATACATACATACA 12: 40,185,261 probably null Het
Lyst G A 13: 13,644,087 G1314D possibly damaging Het
Mmp10 A T 9: 7,505,525 probably null Het
Mmp13 A G 9: 7,277,926 D273G probably benign Het
Morc2a G A 11: 3,675,885 V162M probably benign Het
Msh4 C T 3: 153,876,720 R417Q possibly damaging Het
Nedd9 A T 13: 41,311,794 V790E probably damaging Het
Nlgn1 C A 3: 25,436,134 L476F probably damaging Het
Nox4 C A 7: 87,295,889 Q118K probably benign Het
Nxf1 A G 19: 8,772,131 T131A possibly damaging Het
Olfr1261 T A 2: 89,993,800 probably null Het
Olfr13 T A 6: 43,174,821 S278R probably damaging Het
Olfr1361 A T 13: 21,659,286 S12R possibly damaging Het
Olfr1447 A T 19: 12,901,288 I164K possibly damaging Het
Olfr518 T A 7: 108,880,713 T298S probably benign Het
Olfr643 A T 7: 104,059,309 S98T probably benign Het
Oog3 C A 4: 144,158,438 R309S probably benign Het
Oosp3 C T 19: 11,701,014 probably benign Het
P2ry6 A G 7: 100,938,423 V243A probably damaging Het
Pgc C A 17: 47,733,790 P321T probably damaging Het
Prkd1 G A 12: 50,394,926 H277Y probably damaging Het
Prkdc T A 16: 15,734,058 S2043T probably damaging Het
Rasal3 T C 17: 32,403,098 N96D possibly damaging Het
Rnf4 T C 5: 34,351,280 F162S probably damaging Het
Ros1 A T 10: 52,161,811 N421K probably damaging Het
Rtn4rl1 A G 11: 75,265,927 D395G probably benign Het
Sema3d T A 5: 12,508,084 probably benign Het
Slc12a2 T C 18: 57,904,235 I501T probably damaging Het
Slc12a7 C T 13: 73,795,113 T382I probably benign Het
Slc16a12 T A 19: 34,680,381 I41L probably benign Het
Slc1a1 C A 19: 28,911,794 T489K probably benign Het
Slc24a3 C T 2: 145,613,592 P467L probably damaging Het
Snai2 A T 16: 14,707,044 Y138F possibly damaging Het
Sorcs1 A C 19: 50,475,422 Y197D probably damaging Het
Sppl2a T A 2: 126,917,794 probably benign Het
Srgap3 G A 6: 112,722,904 P1038S probably benign Het
Ttn T C 2: 76,724,463 E30699G probably damaging Het
Vmn2r124 T A 17: 18,062,944 M300K possibly damaging Het
Vwf T C 6: 125,647,906 S1873P possibly damaging Het
Wrap73 A G 4: 154,156,131 D360G probably damaging Het
Zfp366 T C 13: 99,229,561 M410T probably damaging Het
Zfp608 C T 18: 54,987,739 V259I probably benign Het
Zfp69 C T 4: 120,947,498 probably benign Het
Zfp995 T C 17: 21,879,964 T430A probably benign Het
Other mutations in Scn8a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Scn8a APN 15 100955532 unclassified probably benign
IGL00979:Scn8a APN 15 100955406 unclassified probably benign
IGL01339:Scn8a APN 15 101032201 missense probably benign
IGL01992:Scn8a APN 15 100969057 missense probably damaging 1.00
IGL02215:Scn8a APN 15 101029572 splice site probably null
IGL02311:Scn8a APN 15 101013283 missense probably damaging 0.97
IGL02404:Scn8a APN 15 101039730 missense probably damaging 1.00
IGL02652:Scn8a APN 15 101013476 missense probably damaging 0.98
IGL02690:Scn8a APN 15 100970254 missense probably damaging 1.00
IGL02704:Scn8a APN 15 101008062 missense possibly damaging 0.94
IGL03084:Scn8a APN 15 101017172 missense probably damaging 1.00
IGL03108:Scn8a APN 15 100974615 missense probably benign
IGL03224:Scn8a APN 15 101035639 missense probably damaging 1.00
dan UTSW 15 101035624 nonsense probably null
nymph UTSW 15 101035646 missense probably damaging 1.00
Tremord UTSW 15 101013504 missense probably damaging 1.00
3-1:Scn8a UTSW 15 101039939 missense probably benign 0.04
PIT4280001:Scn8a UTSW 15 100957489 missense probably damaging 1.00
PIT4508001:Scn8a UTSW 15 101029692 missense probably damaging 0.98
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0010:Scn8a UTSW 15 101013573 missense probably damaging 1.00
R0254:Scn8a UTSW 15 101018364 missense probably damaging 1.00
R0412:Scn8a UTSW 15 101008306 splice site probably benign
R0538:Scn8a UTSW 15 101035624 nonsense probably null
R0539:Scn8a UTSW 15 101016568 missense probably damaging 1.00
R0631:Scn8a UTSW 15 101035537 missense probably damaging 1.00
R0726:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R0945:Scn8a UTSW 15 101015787 missense possibly damaging 0.54
R0967:Scn8a UTSW 15 101035646 missense probably damaging 1.00
R1164:Scn8a UTSW 15 101040162 missense probably benign 0.06
R1283:Scn8a UTSW 15 100969171 missense possibly damaging 0.82
R1368:Scn8a UTSW 15 101035541 missense probably damaging 1.00
R1633:Scn8a UTSW 15 101029815 missense probably benign 0.01
R1694:Scn8a UTSW 15 100955528 nonsense probably null
R1735:Scn8a UTSW 15 101015861 missense possibly damaging 0.94
R1773:Scn8a UTSW 15 101039615 missense probably damaging 0.97
R1940:Scn8a UTSW 15 100970204 missense probably benign 0.22
R1996:Scn8a UTSW 15 101024379 missense probably damaging 1.00
R2107:Scn8a UTSW 15 101018363 missense probably damaging 0.99
R2251:Scn8a UTSW 15 101017106 missense probably benign 0.02
R2516:Scn8a UTSW 15 100969162 missense probably benign 0.05
R2917:Scn8a UTSW 15 101039732 missense probably damaging 1.00
R3417:Scn8a UTSW 15 100971668 splice site probably benign
R3896:Scn8a UTSW 15 101035498 missense probably benign
R4024:Scn8a UTSW 15 101039793 missense probably damaging 1.00
R4050:Scn8a UTSW 15 101013413 nonsense probably null
R4193:Scn8a UTSW 15 100971603 missense probably damaging 1.00
R4212:Scn8a UTSW 15 100957073 missense possibly damaging 0.88
R4358:Scn8a UTSW 15 100940133 missense probably benign 0.00
R4396:Scn8a UTSW 15 100972830 missense probably damaging 1.00
R4428:Scn8a UTSW 15 100983903 missense probably damaging 1.00
R4452:Scn8a UTSW 15 100957091 missense possibly damaging 0.95
R4631:Scn8a UTSW 15 101016503 nonsense probably null
R4693:Scn8a UTSW 15 101015691 missense probably damaging 1.00
R4765:Scn8a UTSW 15 101040471 missense probably benign 0.07
R4777:Scn8a UTSW 15 101015951 missense probably damaging 1.00
R4949:Scn8a UTSW 15 101029782 missense probably damaging 1.00
R4997:Scn8a UTSW 15 100957054 missense probably damaging 1.00
R5246:Scn8a UTSW 15 101011057 missense probably damaging 1.00
R5566:Scn8a UTSW 15 100974534 missense probably damaging 1.00
R5875:Scn8a UTSW 15 100972822 nonsense probably null
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6031:Scn8a UTSW 15 100983984 missense probably damaging 1.00
R6057:Scn8a UTSW 15 100974667 missense possibly damaging 0.94
R6114:Scn8a UTSW 15 101040596 missense probably damaging 0.99
R6362:Scn8a UTSW 15 100940115 unclassified probably null
R6535:Scn8a UTSW 15 100959707 intron probably benign
R6677:Scn8a UTSW 15 100969072 missense probably damaging 1.00
R6687:Scn8a UTSW 15 100974627 missense probably benign 0.12
R6701:Scn8a UTSW 15 101040096 missense probably damaging 1.00
R6719:Scn8a UTSW 15 101011015 critical splice acceptor site probably null
R6739:Scn8a UTSW 15 101015955 missense possibly damaging 0.82
R6769:Scn8a UTSW 15 101035564 missense probably benign
R6786:Scn8a UTSW 15 101032215 missense probably benign 0.00
R6849:Scn8a UTSW 15 100955587 intron probably null
R7108:Scn8a UTSW 15 101039778 missense probably benign 0.01
R7215:Scn8a UTSW 15 101029830 missense possibly damaging 0.80
R7217:Scn8a UTSW 15 100970227 missense probably benign 0.00
R7219:Scn8a UTSW 15 100969103 missense probably damaging 1.00
R7356:Scn8a UTSW 15 100957579 missense probably damaging 1.00
R7479:Scn8a UTSW 15 100955477 missense probably damaging 0.99
X0066:Scn8a UTSW 15 101040080 missense probably damaging 1.00
X0066:Scn8a UTSW 15 101040081 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAACAAAATGGAGCCTGTCCTGTG -3'
(R):5'- AATCAAATGACCTCAGAAGGCCCTG -3'

Sequencing Primer
(F):5'- ACATCCAGGTGTTGATGGC -3'
(R):5'- TTTTAGTGGAGAGGCCAACTAATCG -3'
Posted On2014-05-09