Incidental Mutation 'R1670:Pogz'
ID187530
Institutional Source Beutler Lab
Gene Symbol Pogz
Ensembl Gene ENSMUSG00000038902
Gene Namepogo transposable element with ZNF domain
Synonyms9530006B08Rik
MMRRC Submission 039706-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.533) question?
Stock #R1670 (G1)
Quality Score221
Status Validated
Chromosome3
Chromosomal Location94837567-94882326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 94878849 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 863 (T863I)
Ref Sequence ENSEMBL: ENSMUSP00000102887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042402] [ENSMUST00000107266] [ENSMUST00000107269] [ENSMUST00000107270]
Predicted Effect probably benign
Transcript: ENSMUST00000042402
AA Change: T907I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000037523
Gene: ENSMUSG00000038902
AA Change: T907I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 328 335 N/A INTRINSIC
PDB:2E72|A 362 393 5e-16 PDB
low complexity region 401 436 N/A INTRINSIC
ZnF_C2H2 482 504 1.64e-1 SMART
ZnF_C2H2 518 541 5.34e0 SMART
ZnF_C2H2 548 571 4.79e-3 SMART
ZnF_C2H2 578 601 9.3e-1 SMART
ZnF_C2H2 607 629 3.34e-2 SMART
ZnF_C2H2 635 657 1.13e1 SMART
ZnF_C2H2 758 781 9.46e0 SMART
ZnF_C2H2 802 827 5.26e1 SMART
low complexity region 896 915 N/A INTRINSIC
low complexity region 946 955 N/A INTRINSIC
low complexity region 984 996 N/A INTRINSIC
CENPB 1008 1072 3.84e-15 SMART
Pfam:DDE_1 1104 1289 3.3e-22 PFAM
low complexity region 1355 1365 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107266
AA Change: T863I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000102887
Gene: ENSMUSG00000038902
AA Change: T863I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 186 213 N/A INTRINSIC
low complexity region 284 291 N/A INTRINSIC
PDB:2E72|A 318 349 6e-16 PDB
low complexity region 357 392 N/A INTRINSIC
ZnF_C2H2 438 460 1.64e-1 SMART
ZnF_C2H2 474 497 5.34e0 SMART
ZnF_C2H2 504 527 4.79e-3 SMART
ZnF_C2H2 534 557 9.3e-1 SMART
ZnF_C2H2 563 585 3.34e-2 SMART
ZnF_C2H2 591 613 1.13e1 SMART
ZnF_C2H2 714 737 9.46e0 SMART
ZnF_C2H2 758 783 5.26e1 SMART
low complexity region 852 871 N/A INTRINSIC
low complexity region 902 911 N/A INTRINSIC
low complexity region 940 952 N/A INTRINSIC
CENPB 964 1028 3.84e-15 SMART
Pfam:DDE_1 1060 1245 1.1e-22 PFAM
low complexity region 1311 1321 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107269
AA Change: T821I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102890
Gene: ENSMUSG00000038902
AA Change: T821I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 144 171 N/A INTRINSIC
low complexity region 242 249 N/A INTRINSIC
PDB:2E72|A 276 307 5e-16 PDB
low complexity region 315 350 N/A INTRINSIC
ZnF_C2H2 396 418 1.64e-1 SMART
ZnF_C2H2 432 455 5.34e0 SMART
ZnF_C2H2 462 485 4.79e-3 SMART
ZnF_C2H2 492 515 9.3e-1 SMART
ZnF_C2H2 521 543 3.34e-2 SMART
ZnF_C2H2 549 571 1.13e1 SMART
ZnF_C2H2 672 695 9.46e0 SMART
ZnF_C2H2 716 741 5.26e1 SMART
low complexity region 810 829 N/A INTRINSIC
low complexity region 860 869 N/A INTRINSIC
low complexity region 898 910 N/A INTRINSIC
CENPB 922 986 3.84e-15 SMART
Pfam:DDE_1 1018 1203 1.1e-22 PFAM
low complexity region 1269 1279 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107270
AA Change: T916I

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000102891
Gene: ENSMUSG00000038902
AA Change: T916I

DomainStartEndE-ValueType
low complexity region 9 16 N/A INTRINSIC
low complexity region 41 54 N/A INTRINSIC
low complexity region 239 266 N/A INTRINSIC
low complexity region 337 344 N/A INTRINSIC
PDB:2E72|A 371 402 5e-16 PDB
low complexity region 410 445 N/A INTRINSIC
ZnF_C2H2 491 513 1.64e-1 SMART
ZnF_C2H2 527 550 5.34e0 SMART
ZnF_C2H2 557 580 4.79e-3 SMART
ZnF_C2H2 587 610 9.3e-1 SMART
ZnF_C2H2 616 638 3.34e-2 SMART
ZnF_C2H2 644 666 1.13e1 SMART
ZnF_C2H2 767 790 9.46e0 SMART
ZnF_C2H2 811 836 5.26e1 SMART
low complexity region 905 924 N/A INTRINSIC
low complexity region 955 964 N/A INTRINSIC
low complexity region 993 1005 N/A INTRINSIC
CENPB 1017 1081 3.84e-15 SMART
Pfam:DDE_1 1150 1298 1.5e-18 PFAM
low complexity region 1364 1374 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142253
Meta Mutation Damage Score 0.084 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be a zinc finger protein containing a transposase domain at the C-terminus. This protein was found to interact with the transcription factor SP1 in a yeast two-hybrid system. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,712,379 P187S probably damaging Het
Abcc9 A G 6: 142,594,722 V1497A possibly damaging Het
Adam15 T C 3: 89,348,510 probably benign Het
Angel2 T A 1: 190,942,163 S371T probably benign Het
Atr T A 9: 95,861,456 N49K probably benign Het
Bace2 G A 16: 97,412,135 M228I probably damaging Het
Bdp1 A C 13: 100,027,433 probably null Het
Calr A T 8: 84,844,119 D302E probably benign Het
Camta1 T C 4: 151,079,771 D340G probably benign Het
Car11 C T 7: 45,703,525 T236I possibly damaging Het
Cfap69 A T 5: 5,586,409 S275T probably benign Het
Cib2 G A 9: 54,548,369 R104W probably damaging Het
CN725425 T C 15: 91,245,815 S294P possibly damaging Het
Coro7 G A 16: 4,628,233 S876F possibly damaging Het
Cspg4 G A 9: 56,897,403 V1833M probably damaging Het
Dennd6b C A 15: 89,185,337 probably benign Het
Dhx30 A T 9: 110,085,273 Y979N possibly damaging Het
Dnah8 A T 17: 30,725,124 I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 I3976N possibly damaging Het
Ebi3 T C 17: 55,954,479 I125T probably damaging Het
Elfn2 C T 15: 78,672,368 A660T probably benign Het
F12 C T 13: 55,421,533 C209Y probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam126a T A 5: 23,999,991 M1L possibly damaging Het
Fgfr2 T A 7: 130,180,457 D413V probably damaging Het
Gdf10 T A 14: 33,932,043 I169N possibly damaging Het
Gdnf T C 15: 7,815,649 V41A probably benign Het
Gm9857 A T 3: 108,940,162 probably benign Het
Gpatch11 A G 17: 78,839,100 E58G possibly damaging Het
Gpr55 A G 1: 85,941,415 V148A possibly damaging Het
Gucy1b1 A G 3: 82,045,460 I222T probably benign Het
Hnf4a T C 2: 163,562,576 S227P probably damaging Het
Hsfy2 A G 1: 56,636,389 S330P possibly damaging Het
Ift122 T C 6: 115,923,883 V1054A probably benign Het
Il27 T A 7: 126,589,475 E175D probably benign Het
Lactb2 A T 1: 13,660,417 S12T probably damaging Het
Lrfn2 T C 17: 49,096,577 V576A probably benign Het
Mansc4 C G 6: 147,075,191 R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,275,958 probably benign Het
Mrpl16 C T 19: 11,774,595 R240* probably null Het
Muc3 A G 5: 137,143,995 V70A probably benign Het
Ndnf A G 6: 65,703,070 D111G probably benign Het
Nek4 T C 14: 30,982,427 F688S probably damaging Het
Nkx2-6 T A 14: 69,174,677 M98K probably benign Het
Nup188 T C 2: 30,340,655 S1402P probably benign Het
Olfr1036 T A 2: 86,075,250 V170D probably benign Het
Olfr1307 C T 2: 111,944,919 C179Y probably damaging Het
Olfr205 A T 16: 59,329,244 N88K probably benign Het
Olfr206 T C 16: 59,345,427 I91M possibly damaging Het
Olfr330 A T 11: 58,529,411 S192T probably damaging Het
Olfr418 T A 1: 173,270,900 S242T probably damaging Het
Olfr556 A G 7: 102,670,402 T161A possibly damaging Het
Parp10 A T 15: 76,242,070 V306E probably benign Het
Pcnx3 A G 19: 5,673,315 L1284P probably damaging Het
Pld1 A T 3: 28,049,240 I365F probably benign Het
Pnisr A G 4: 21,865,893 D294G probably damaging Het
Ptprn2 A C 12: 116,722,172 T84P possibly damaging Het
Rln1 C T 19: 29,332,068 E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 S271P probably damaging Het
Rngtt A G 4: 33,368,660 T398A probably benign Het
Rprd2 G T 3: 95,764,803 T1096K probably damaging Het
Sema3e C T 5: 14,162,185 probably benign Het
Sema5a T A 15: 32,548,799 C140S probably damaging Het
Shpk A C 11: 73,222,931 D390A probably benign Het
Slc22a20 C T 19: 5,972,848 probably benign Het
Steap2 A G 5: 5,677,393 V314A possibly damaging Het
Stxbp5l A G 16: 37,290,927 probably null Het
Tgm3 G T 2: 130,041,768 E449* probably null Het
Tmem68 A C 4: 3,560,627 L186V probably damaging Het
Ttc41 T A 10: 86,776,252 W1130R possibly damaging Het
Ttpal T C 2: 163,615,366 F253L possibly damaging Het
Vmn2r99 G T 17: 19,362,252 V40F probably benign Het
Xkr9 G A 1: 13,700,943 V228M probably damaging Het
Zc3h7b C T 15: 81,777,067 A369V probably benign Het
Other mutations in Pogz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Pogz APN 3 94874703 unclassified probably benign
IGL02225:Pogz APN 3 94879016 missense probably damaging 0.99
IGL02377:Pogz APN 3 94879010 missense probably damaging 1.00
IGL02468:Pogz APN 3 94879083 missense probably damaging 0.97
IGL02672:Pogz APN 3 94856099 missense probably benign 0.08
IGL03290:Pogz APN 3 94875091 unclassified probably benign
FR4976:Pogz UTSW 3 94874695 unclassified probably benign
PIT4382001:Pogz UTSW 3 94879796 missense probably damaging 1.00
PIT4434001:Pogz UTSW 3 94872370 missense probably damaging 1.00
R0326:Pogz UTSW 3 94870113 missense probably damaging 1.00
R0401:Pogz UTSW 3 94877025 missense possibly damaging 0.81
R0479:Pogz UTSW 3 94876636 missense possibly damaging 0.92
R0586:Pogz UTSW 3 94879353 missense probably damaging 1.00
R1349:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1372:Pogz UTSW 3 94860888 missense probably damaging 1.00
R1780:Pogz UTSW 3 94870126 missense possibly damaging 0.54
R1854:Pogz UTSW 3 94878849 missense probably benign 0.21
R1855:Pogz UTSW 3 94878849 missense probably benign 0.21
R1964:Pogz UTSW 3 94878193 missense probably benign 0.36
R1995:Pogz UTSW 3 94877944 missense probably damaging 1.00
R2109:Pogz UTSW 3 94878965 missense probably benign
R2139:Pogz UTSW 3 94871007 missense possibly damaging 0.95
R4457:Pogz UTSW 3 94856063 missense probably benign 0.14
R4598:Pogz UTSW 3 94880180 missense possibly damaging 0.52
R5598:Pogz UTSW 3 94864509 missense probably damaging 1.00
R5999:Pogz UTSW 3 94856117 missense possibly damaging 0.77
R6104:Pogz UTSW 3 94880031 missense probably benign 0.09
R7017:Pogz UTSW 3 94854024 missense probably damaging 0.99
Z1088:Pogz UTSW 3 94879076 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAATCTCATTTTCCCAGGGCTCAG -3'
(R):5'- AAGTGTTCAGCCGCCTGTTCAG -3'

Sequencing Primer
(F):5'- GGACACTTTGCACAATGTCTG -3'
(R):5'- TTGCAGCACAGGGCAAAC -3'
Posted On2014-05-09