Incidental Mutation 'R1670:Fgfr2'
ID187552
Institutional Source Beutler Lab
Gene Symbol Fgfr2
Ensembl Gene ENSMUSG00000030849
Gene Namefibroblast growth factor receptor 2
SynonymsFgfr-2, KGFRTr, Bek, Fgfr7, Fgfr-7, svs
MMRRC Submission 039706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1670 (G1)
Quality Score201
Status Validated
Chromosome7
Chromosomal Location130162451-133123350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 130180457 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 413 (D413V)
Ref Sequence ENSEMBL: ENSMUSP00000112585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117073] [ENSMUST00000117089] [ENSMUST00000117357] [ENSMUST00000117691] [ENSMUST00000117754] [ENSMUST00000117858] [ENSMUST00000117872] [ENSMUST00000118296] [ENSMUST00000119260] [ENSMUST00000120141] [ENSMUST00000120187] [ENSMUST00000120715] [ENSMUST00000121064] [ENSMUST00000121080] [ENSMUST00000122054] [ENSMUST00000122448] [ENSMUST00000124096] [ENSMUST00000153166]
Predicted Effect probably damaging
Transcript: ENSMUST00000117073
AA Change: D410V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112672
Gene: ENSMUSG00000030849
AA Change: D410V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 234 7.41e-7 SMART
transmembrane domain 260 282 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
TyrKc 364 640 4.38e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117089
AA Change: D526V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112992
Gene: ENSMUSG00000030849
AA Change: D526V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 430 439 N/A INTRINSIC
TyrKc 480 756 4.38e-152 SMART
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117357
AA Change: D411V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112580
Gene: ENSMUSG00000030849
AA Change: D411V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
low complexity region 669 683 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117691
AA Change: D528V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113180
Gene: ENSMUSG00000030849
AA Change: D528V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
low complexity region 786 800 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117754
AA Change: D314V

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000113187
Gene: ENSMUSG00000030849
AA Change: D314V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 136 7.41e-7 SMART
transmembrane domain 162 184 N/A INTRINSIC
low complexity region 218 227 N/A INTRINSIC
TyrKc 268 544 4.38e-152 SMART
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117858
AA Change: D528V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112623
Gene: ENSMUSG00000030849
AA Change: D528V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117872
AA Change: D429V

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113994
Gene: ENSMUSG00000030849
AA Change: D429V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 253 7.41e-7 SMART
transmembrane domain 279 301 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
TyrKc 383 659 4.38e-152 SMART
low complexity region 687 701 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118296
AA Change: D439V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112471
Gene: ENSMUSG00000030849
AA Change: D439V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
TyrKc 393 669 4.38e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119260
AA Change: D525V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113010
Gene: ENSMUSG00000030849
AA Change: D525V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 349 7.41e-7 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
TyrKc 479 755 4.38e-152 SMART
low complexity region 783 797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120141
AA Change: D437V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113415
Gene: ENSMUSG00000030849
AA Change: D437V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
TyrKc 391 667 4.38e-152 SMART
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120187
AA Change: D432V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113248
Gene: ENSMUSG00000030849
AA Change: D432V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 251 1.9e-4 SMART
transmembrane domain 280 302 N/A INTRINSIC
low complexity region 336 345 N/A INTRINSIC
TyrKc 386 662 4.38e-152 SMART
low complexity region 690 704 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120715
AA Change: D415V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000113474
Gene: ENSMUSG00000030849
AA Change: D415V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
TyrKc 369 645 4.38e-152 SMART
low complexity region 673 687 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121064
AA Change: D315V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113452
Gene: ENSMUSG00000030849
AA Change: D315V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 134 1.9e-4 SMART
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
TyrKc 269 545 4.38e-152 SMART
low complexity region 573 587 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121080
AA Change: D413V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112585
Gene: ENSMUSG00000030849
AA Change: D413V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 317 326 N/A INTRINSIC
TyrKc 367 643 4.38e-152 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000122054
AA Change: D546V

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112430
Gene: ENSMUSG00000030849
AA Change: D546V

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
IGc2 288 368 7.41e-7 SMART
transmembrane domain 394 416 N/A INTRINSIC
low complexity region 450 459 N/A INTRINSIC
TyrKc 500 776 4.38e-152 SMART
low complexity region 804 818 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000122448
AA Change: D411V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113993
Gene: ENSMUSG00000030849
AA Change: D411V

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129542
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133806
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147859
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148675
Predicted Effect probably benign
Transcript: ENSMUST00000153166
SMART Domains Protein: ENSMUSP00000120100
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
SCOP:d1ev2e1 269 311 1e-5 SMART
Meta Mutation Damage Score 0.372 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for null mutations die as embryos. Isoform IIIb deficient mutants die at birth with defects in multiple organs and tissues. Isoform IIIc deficient mutants have defects in osteoblast and chondrocyte lineages, producing dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,712,379 P187S probably damaging Het
Abcc9 A G 6: 142,594,722 V1497A possibly damaging Het
Adam15 T C 3: 89,348,510 probably benign Het
Angel2 T A 1: 190,942,163 S371T probably benign Het
Atr T A 9: 95,861,456 N49K probably benign Het
Bace2 G A 16: 97,412,135 M228I probably damaging Het
Bdp1 A C 13: 100,027,433 probably null Het
Calr A T 8: 84,844,119 D302E probably benign Het
Camta1 T C 4: 151,079,771 D340G probably benign Het
Car11 C T 7: 45,703,525 T236I possibly damaging Het
Cfap69 A T 5: 5,586,409 S275T probably benign Het
Cib2 G A 9: 54,548,369 R104W probably damaging Het
CN725425 T C 15: 91,245,815 S294P possibly damaging Het
Coro7 G A 16: 4,628,233 S876F possibly damaging Het
Cspg4 G A 9: 56,897,403 V1833M probably damaging Het
Dennd6b C A 15: 89,185,337 probably benign Het
Dhx30 A T 9: 110,085,273 Y979N possibly damaging Het
Dnah8 A T 17: 30,725,124 I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 I3976N possibly damaging Het
Ebi3 T C 17: 55,954,479 I125T probably damaging Het
Elfn2 C T 15: 78,672,368 A660T probably benign Het
F12 C T 13: 55,421,533 C209Y probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam126a T A 5: 23,999,991 M1L possibly damaging Het
Gdf10 T A 14: 33,932,043 I169N possibly damaging Het
Gdnf T C 15: 7,815,649 V41A probably benign Het
Gm9857 A T 3: 108,940,162 probably benign Het
Gpatch11 A G 17: 78,839,100 E58G possibly damaging Het
Gpr55 A G 1: 85,941,415 V148A possibly damaging Het
Gucy1b1 A G 3: 82,045,460 I222T probably benign Het
Hnf4a T C 2: 163,562,576 S227P probably damaging Het
Hsfy2 A G 1: 56,636,389 S330P possibly damaging Het
Ift122 T C 6: 115,923,883 V1054A probably benign Het
Il27 T A 7: 126,589,475 E175D probably benign Het
Lactb2 A T 1: 13,660,417 S12T probably damaging Het
Lrfn2 T C 17: 49,096,577 V576A probably benign Het
Mansc4 C G 6: 147,075,191 R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,275,958 probably benign Het
Mrpl16 C T 19: 11,774,595 R240* probably null Het
Muc3 A G 5: 137,143,995 V70A probably benign Het
Ndnf A G 6: 65,703,070 D111G probably benign Het
Nek4 T C 14: 30,982,427 F688S probably damaging Het
Nkx2-6 T A 14: 69,174,677 M98K probably benign Het
Nup188 T C 2: 30,340,655 S1402P probably benign Het
Olfr1036 T A 2: 86,075,250 V170D probably benign Het
Olfr1307 C T 2: 111,944,919 C179Y probably damaging Het
Olfr205 A T 16: 59,329,244 N88K probably benign Het
Olfr206 T C 16: 59,345,427 I91M possibly damaging Het
Olfr330 A T 11: 58,529,411 S192T probably damaging Het
Olfr418 T A 1: 173,270,900 S242T probably damaging Het
Olfr556 A G 7: 102,670,402 T161A possibly damaging Het
Parp10 A T 15: 76,242,070 V306E probably benign Het
Pcnx3 A G 19: 5,673,315 L1284P probably damaging Het
Pld1 A T 3: 28,049,240 I365F probably benign Het
Pnisr A G 4: 21,865,893 D294G probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ptprn2 A C 12: 116,722,172 T84P possibly damaging Het
Rln1 C T 19: 29,332,068 E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 S271P probably damaging Het
Rngtt A G 4: 33,368,660 T398A probably benign Het
Rprd2 G T 3: 95,764,803 T1096K probably damaging Het
Sema3e C T 5: 14,162,185 probably benign Het
Sema5a T A 15: 32,548,799 C140S probably damaging Het
Shpk A C 11: 73,222,931 D390A probably benign Het
Slc22a20 C T 19: 5,972,848 probably benign Het
Steap2 A G 5: 5,677,393 V314A possibly damaging Het
Stxbp5l A G 16: 37,290,927 probably null Het
Tgm3 G T 2: 130,041,768 E449* probably null Het
Tmem68 A C 4: 3,560,627 L186V probably damaging Het
Ttc41 T A 10: 86,776,252 W1130R possibly damaging Het
Ttpal T C 2: 163,615,366 F253L possibly damaging Het
Vmn2r99 G T 17: 19,362,252 V40F probably benign Het
Xkr9 G A 1: 13,700,943 V228M probably damaging Het
Zc3h7b C T 15: 81,777,067 A369V probably benign Het
Other mutations in Fgfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Fgfr2 APN 7 130167711 missense probably benign 0.45
IGL00594:Fgfr2 APN 7 130228723 missense probably damaging 1.00
IGL00963:Fgfr2 APN 7 130228761 missense probably damaging 0.99
IGL01968:Fgfr2 APN 7 130185248 missense probably damaging 1.00
IGL02003:Fgfr2 APN 7 130219072 missense probably damaging 1.00
IGL02063:Fgfr2 APN 7 130167755 missense probably damaging 1.00
IGL02239:Fgfr2 APN 7 130177686 missense probably damaging 1.00
IGL02349:Fgfr2 APN 7 130242606 missense probably damaging 1.00
IGL02630:Fgfr2 APN 7 130228795 splice site probably null
IGL02639:Fgfr2 APN 7 130228802 splice site probably benign
IGL03058:Fgfr2 APN 7 130182692 missense probably damaging 1.00
IGL03263:Fgfr2 APN 7 130180419 missense probably benign 0.12
IGL03377:Fgfr2 APN 7 130198517 missense probably damaging 0.98
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0078:Fgfr2 UTSW 7 130201075 missense possibly damaging 0.95
R0085:Fgfr2 UTSW 7 130196263 missense probably damaging 0.99
R0278:Fgfr2 UTSW 7 130261862 unclassified probably null
R0335:Fgfr2 UTSW 7 130196249 missense probably benign 0.00
R0557:Fgfr2 UTSW 7 130219081 missense probably damaging 1.00
R0631:Fgfr2 UTSW 7 130227239 intron probably benign
R0637:Fgfr2 UTSW 7 130171624 missense possibly damaging 0.89
R0841:Fgfr2 UTSW 7 130261905 missense probably benign 0.03
R0841:Fgfr2 UTSW 7 130772007 unclassified probably benign
R1646:Fgfr2 UTSW 7 130242644 missense probably damaging 1.00
R1678:Fgfr2 UTSW 7 130228620 splice site probably null
R1950:Fgfr2 UTSW 7 130198481 missense probably damaging 0.96
R2393:Fgfr2 UTSW 7 130227238 intron probably null
R3706:Fgfr2 UTSW 7 130198431 missense probably benign 0.31
R3717:Fgfr2 UTSW 7 130182757 missense probably damaging 1.00
R3808:Fgfr2 UTSW 7 130199848 missense probably benign 0.01
R3945:Fgfr2 UTSW 7 130177755 missense possibly damaging 0.71
R4438:Fgfr2 UTSW 7 130172930 nonsense probably null
R4718:Fgfr2 UTSW 7 130261788 missense probably damaging 1.00
R4779:Fgfr2 UTSW 7 130185193 intron probably benign
R4925:Fgfr2 UTSW 7 130185272 missense probably damaging 1.00
R4932:Fgfr2 UTSW 7 130241277 missense probably damaging 1.00
R4941:Fgfr2 UTSW 7 130198445 missense probably benign 0.21
R4980:Fgfr2 UTSW 7 130201080 missense probably damaging 1.00
R5304:Fgfr2 UTSW 7 130167774 missense probably damaging 1.00
R5313:Fgfr2 UTSW 7 130241240 missense probably benign 0.01
R5375:Fgfr2 UTSW 7 130241215 missense possibly damaging 0.65
R5652:Fgfr2 UTSW 7 130261863 missense probably damaging 1.00
R6120:Fgfr2 UTSW 7 130228690 missense probably benign 0.24
R6347:Fgfr2 UTSW 7 130261757 missense probably damaging 1.00
R6375:Fgfr2 UTSW 7 130167745 missense probably damaging 1.00
R6475:Fgfr2 UTSW 7 130201120 missense probably benign 0.03
R6481:Fgfr2 UTSW 7 130185278 missense possibly damaging 0.85
R6494:Fgfr2 UTSW 7 130198550 missense probably damaging 1.00
R6542:Fgfr2 UTSW 7 130201123 missense probably benign 0.02
X0024:Fgfr2 UTSW 7 130185329 missense probably damaging 0.99
Z1088:Fgfr2 UTSW 7 130169799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCCCAGTTGTTTCTAGTTGAAGCC -3'
(R):5'- AGATTTGGTCCCAACGTTTGCCC -3'

Sequencing Primer
(F):5'- CTAGTTGAAGCCTGGCAGTC -3'
(R):5'- GTTACTGAGCATGGCACTCAC -3'
Posted On2014-05-09