Incidental Mutation 'R1670:Calr'
ID187554
Institutional Source Beutler Lab
Gene Symbol Calr
Ensembl Gene ENSMUSG00000003814
Gene Namecalreticulin
SynonymsCalregulin, CRT
MMRRC Submission 039706-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1670 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location84841850-84846934 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84844119 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 302 (D302E)
Ref Sequence ENSEMBL: ENSMUSP00000003912 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003911] [ENSMUST00000003912] [ENSMUST00000109761] [ENSMUST00000128035]
PDB Structure
Crystal structure of the calreticulin lectin domain [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural basis of carbohydrate recognition by calreticulin [X-RAY DIFFRACTION]
Structural and functional relationships between the lectin and arm domains of calreticulin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000003911
SMART Domains Protein: ENSMUSP00000003911
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 229 272 5.7e-8 SMART
low complexity region 296 307 N/A INTRINSIC
UBA 319 356 9.11e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000003912
AA Change: D302E

PolyPhen 2 Score 0.237 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000003912
Gene: ENSMUSG00000003814
AA Change: D302E

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:Calreticulin 23 258 2.7e-64 PFAM
Pfam:Calreticulin 257 332 3.3e-24 PFAM
low complexity region 358 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109761
SMART Domains Protein: ENSMUSP00000105383
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
low complexity region 297 308 N/A INTRINSIC
UBA 320 357 9.11e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125711
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128028
Predicted Effect probably benign
Transcript: ENSMUST00000128035
SMART Domains Protein: ENSMUSP00000115664
Gene: ENSMUSG00000003813

DomainStartEndE-ValueType
UBQ 3 77 3.28e-23 SMART
low complexity region 123 151 N/A INTRINSIC
UBA 163 200 8.76e-11 SMART
STI1 230 273 5.7e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141347
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147538
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154774
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calreticulin is a multifunctional protein that acts as a major Ca(2+)-binding (storage) protein in the lumen of the endoplasmic reticulum. It is also found in the nucleus, suggesting that it may have a role in transcription regulation. Calreticulin binds to the synthetic peptide KLGFFKR, which is almost identical to an amino acid sequence in the DNA-binding domain of the superfamily of nuclear receptors. Calreticulin binds to antibodies in certain sera of systemic lupus and Sjogren patients which contain anti-Ro/SSA antibodies, it is highly conserved among species, and it is located in the endoplasmic and sarcoplasmic reticulum where it may bind calcium. The amino terminus of calreticulin interacts with the DNA-binding domain of the glucocorticoid receptor and prevents the receptor from binding to its specific glucocorticoid response element. Calreticulin can inhibit the binding of androgen receptor to its hormone-responsive DNA element and can inhibit androgen receptor and retinoic acid receptor transcriptional activities in vivo, as well as retinoic acid-induced neuronal differentiation. Thus, calreticulin can act as an important modulator of the regulation of gene transcription by nuclear hormone receptors. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin but calreticulin is not a Ro/SS-A antigen. Earlier papers referred to calreticulin as an Ro/SS-A antigen but this was later disproven. Increased autoantibody titer against human calreticulin is found in infants with complete congenital heart block of both the IgG and IgM classes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit decreased cardiac cell mass, increased apoptosis of cardiac myocytes, neural tube defects (sometimes associated with exencephaly), omphalocele, and mid- to late-gestational lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,712,379 P187S probably damaging Het
Abcc9 A G 6: 142,594,722 V1497A possibly damaging Het
Adam15 T C 3: 89,348,510 probably benign Het
Angel2 T A 1: 190,942,163 S371T probably benign Het
Atr T A 9: 95,861,456 N49K probably benign Het
Bace2 G A 16: 97,412,135 M228I probably damaging Het
Bdp1 A C 13: 100,027,433 probably null Het
Camta1 T C 4: 151,079,771 D340G probably benign Het
Car11 C T 7: 45,703,525 T236I possibly damaging Het
Cfap69 A T 5: 5,586,409 S275T probably benign Het
Cib2 G A 9: 54,548,369 R104W probably damaging Het
CN725425 T C 15: 91,245,815 S294P possibly damaging Het
Coro7 G A 16: 4,628,233 S876F possibly damaging Het
Cspg4 G A 9: 56,897,403 V1833M probably damaging Het
Dennd6b C A 15: 89,185,337 probably benign Het
Dhx30 A T 9: 110,085,273 Y979N possibly damaging Het
Dnah8 A T 17: 30,725,124 I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 I3976N possibly damaging Het
Ebi3 T C 17: 55,954,479 I125T probably damaging Het
Elfn2 C T 15: 78,672,368 A660T probably benign Het
F12 C T 13: 55,421,533 C209Y probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam126a T A 5: 23,999,991 M1L possibly damaging Het
Fgfr2 T A 7: 130,180,457 D413V probably damaging Het
Gdf10 T A 14: 33,932,043 I169N possibly damaging Het
Gdnf T C 15: 7,815,649 V41A probably benign Het
Gm9857 A T 3: 108,940,162 probably benign Het
Gpatch11 A G 17: 78,839,100 E58G possibly damaging Het
Gpr55 A G 1: 85,941,415 V148A possibly damaging Het
Gucy1b1 A G 3: 82,045,460 I222T probably benign Het
Hnf4a T C 2: 163,562,576 S227P probably damaging Het
Hsfy2 A G 1: 56,636,389 S330P possibly damaging Het
Ift122 T C 6: 115,923,883 V1054A probably benign Het
Il27 T A 7: 126,589,475 E175D probably benign Het
Lactb2 A T 1: 13,660,417 S12T probably damaging Het
Lrfn2 T C 17: 49,096,577 V576A probably benign Het
Mansc4 C G 6: 147,075,191 R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,275,958 probably benign Het
Mrpl16 C T 19: 11,774,595 R240* probably null Het
Muc3 A G 5: 137,143,995 V70A probably benign Het
Ndnf A G 6: 65,703,070 D111G probably benign Het
Nek4 T C 14: 30,982,427 F688S probably damaging Het
Nkx2-6 T A 14: 69,174,677 M98K probably benign Het
Nup188 T C 2: 30,340,655 S1402P probably benign Het
Olfr1036 T A 2: 86,075,250 V170D probably benign Het
Olfr1307 C T 2: 111,944,919 C179Y probably damaging Het
Olfr205 A T 16: 59,329,244 N88K probably benign Het
Olfr206 T C 16: 59,345,427 I91M possibly damaging Het
Olfr330 A T 11: 58,529,411 S192T probably damaging Het
Olfr418 T A 1: 173,270,900 S242T probably damaging Het
Olfr556 A G 7: 102,670,402 T161A possibly damaging Het
Parp10 A T 15: 76,242,070 V306E probably benign Het
Pcnx3 A G 19: 5,673,315 L1284P probably damaging Het
Pld1 A T 3: 28,049,240 I365F probably benign Het
Pnisr A G 4: 21,865,893 D294G probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ptprn2 A C 12: 116,722,172 T84P possibly damaging Het
Rln1 C T 19: 29,332,068 E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 S271P probably damaging Het
Rngtt A G 4: 33,368,660 T398A probably benign Het
Rprd2 G T 3: 95,764,803 T1096K probably damaging Het
Sema3e C T 5: 14,162,185 probably benign Het
Sema5a T A 15: 32,548,799 C140S probably damaging Het
Shpk A C 11: 73,222,931 D390A probably benign Het
Slc22a20 C T 19: 5,972,848 probably benign Het
Steap2 A G 5: 5,677,393 V314A possibly damaging Het
Stxbp5l A G 16: 37,290,927 probably null Het
Tgm3 G T 2: 130,041,768 E449* probably null Het
Tmem68 A C 4: 3,560,627 L186V probably damaging Het
Ttc41 T A 10: 86,776,252 W1130R possibly damaging Het
Ttpal T C 2: 163,615,366 F253L possibly damaging Het
Vmn2r99 G T 17: 19,362,252 V40F probably benign Het
Xkr9 G A 1: 13,700,943 V228M probably damaging Het
Zc3h7b C T 15: 81,777,067 A369V probably benign Het
Other mutations in Calr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00540:Calr APN 8 84844744 missense possibly damaging 0.89
IGL00648:Calr APN 8 84842702 unclassified probably benign
IGL01309:Calr APN 8 84846706 critical splice donor site probably null
IGL01910:Calr APN 8 84844969 unclassified probably benign
IGL01918:Calr APN 8 84842850 unclassified probably benign
IGL02399:Calr APN 8 84842786 unclassified probably benign
IGL02749:Calr APN 8 84844488 missense probably damaging 1.00
IGL02858:Calr APN 8 84844899 missense probably benign 0.07
IGL03090:Calr APN 8 84846744 missense possibly damaging 0.82
K3955:Calr UTSW 8 84846273 missense probably damaging 1.00
R0309:Calr UTSW 8 84843031 missense probably benign 0.43
R1974:Calr UTSW 8 84844157 missense probably benign
R6864:Calr UTSW 8 84844928 missense probably damaging 0.98
R7120:Calr UTSW 8 84842828 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGGCGGACCATTTCAGAACACC -3'
(R):5'- CTGACCCTGATGCTAAGAAGCCTG -3'

Sequencing Primer
(F):5'- CTTAGGGTTGGTGCCTCTGC -3'
(R):5'- TGGGAACCACCAGTGATTC -3'
Posted On2014-05-09