Incidental Mutation 'R1670:Cspg4'
ID187558
Institutional Source Beutler Lab
Gene Symbol Cspg4
Ensembl Gene ENSMUSG00000032911
Gene Namechondroitin sulfate proteoglycan 4
SynonymsAN2, 4732461B14Rik, NG2
MMRRC Submission 039706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1670 (G1)
Quality Score209
Status Validated
Chromosome9
Chromosomal Location56865033-56899870 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 56897403 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 1833 (V1833M)
Ref Sequence ENSEMBL: ENSMUSP00000038909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035661]
Predicted Effect probably damaging
Transcript: ENSMUST00000035661
AA Change: V1833M

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038909
Gene: ENSMUSG00000032911
AA Change: V1833M

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
LamG 47 179 9.16e-22 SMART
LamG 223 364 3.52e-23 SMART
low complexity region 384 397 N/A INTRINSIC
Pfam:Cadherin_3 495 646 1e-36 PFAM
Pfam:Cadherin_3 732 885 7.9e-14 PFAM
Pfam:Cadherin_3 868 996 7e-15 PFAM
Pfam:Cadherin_3 972 1115 9e-26 PFAM
Pfam:Cadherin_3 1116 1223 1.1e-10 PFAM
Pfam:Cadherin_3 1225 1344 3.3e-12 PFAM
Pfam:Cadherin_3 1425 1568 6.3e-52 PFAM
Pfam:Cadherin_3 1578 1684 9.7e-9 PFAM
Pfam:Cadherin_3 1674 1809 3.2e-9 PFAM
Pfam:Cadherin_3 1779 1929 1.6e-31 PFAM
transmembrane domain 2229 2251 N/A INTRINSIC
low complexity region 2295 2305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215666
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217052
Meta Mutation Damage Score 0.0916 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A human melanoma-associated chondroitin sulfate proteoglycan plays a role in stabilizing cell-substratum interactions during early events of melanoma cell spreading on endothelial basement membranes. CSPG4 represents an integral membrane chondroitin sulfate proteoglycan expressed by human malignant melanoma cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display abnormal dentate gyrus morphology and abnormal smooth muscle cell physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,712,379 P187S probably damaging Het
Abcc9 A G 6: 142,594,722 V1497A possibly damaging Het
Adam15 T C 3: 89,348,510 probably benign Het
Angel2 T A 1: 190,942,163 S371T probably benign Het
Atr T A 9: 95,861,456 N49K probably benign Het
Bace2 G A 16: 97,412,135 M228I probably damaging Het
Bdp1 A C 13: 100,027,433 probably null Het
Calr A T 8: 84,844,119 D302E probably benign Het
Camta1 T C 4: 151,079,771 D340G probably benign Het
Car11 C T 7: 45,703,525 T236I possibly damaging Het
Cfap69 A T 5: 5,586,409 S275T probably benign Het
Cib2 G A 9: 54,548,369 R104W probably damaging Het
CN725425 T C 15: 91,245,815 S294P possibly damaging Het
Coro7 G A 16: 4,628,233 S876F possibly damaging Het
Dennd6b C A 15: 89,185,337 probably benign Het
Dhx30 A T 9: 110,085,273 Y979N possibly damaging Het
Dnah8 A T 17: 30,725,124 I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 I3976N possibly damaging Het
Ebi3 T C 17: 55,954,479 I125T probably damaging Het
Elfn2 C T 15: 78,672,368 A660T probably benign Het
F12 C T 13: 55,421,533 C209Y probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam126a T A 5: 23,999,991 M1L possibly damaging Het
Fgfr2 T A 7: 130,180,457 D413V probably damaging Het
Gdf10 T A 14: 33,932,043 I169N possibly damaging Het
Gdnf T C 15: 7,815,649 V41A probably benign Het
Gm9857 A T 3: 108,940,162 probably benign Het
Gpatch11 A G 17: 78,839,100 E58G possibly damaging Het
Gpr55 A G 1: 85,941,415 V148A possibly damaging Het
Gucy1b1 A G 3: 82,045,460 I222T probably benign Het
Hnf4a T C 2: 163,562,576 S227P probably damaging Het
Hsfy2 A G 1: 56,636,389 S330P possibly damaging Het
Ift122 T C 6: 115,923,883 V1054A probably benign Het
Il27 T A 7: 126,589,475 E175D probably benign Het
Lactb2 A T 1: 13,660,417 S12T probably damaging Het
Lrfn2 T C 17: 49,096,577 V576A probably benign Het
Mansc4 C G 6: 147,075,191 R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,275,958 probably benign Het
Mrpl16 C T 19: 11,774,595 R240* probably null Het
Muc3 A G 5: 137,143,995 V70A probably benign Het
Ndnf A G 6: 65,703,070 D111G probably benign Het
Nek4 T C 14: 30,982,427 F688S probably damaging Het
Nkx2-6 T A 14: 69,174,677 M98K probably benign Het
Nup188 T C 2: 30,340,655 S1402P probably benign Het
Olfr1036 T A 2: 86,075,250 V170D probably benign Het
Olfr1307 C T 2: 111,944,919 C179Y probably damaging Het
Olfr205 A T 16: 59,329,244 N88K probably benign Het
Olfr206 T C 16: 59,345,427 I91M possibly damaging Het
Olfr330 A T 11: 58,529,411 S192T probably damaging Het
Olfr418 T A 1: 173,270,900 S242T probably damaging Het
Olfr556 A G 7: 102,670,402 T161A possibly damaging Het
Parp10 A T 15: 76,242,070 V306E probably benign Het
Pcnx3 A G 19: 5,673,315 L1284P probably damaging Het
Pld1 A T 3: 28,049,240 I365F probably benign Het
Pnisr A G 4: 21,865,893 D294G probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ptprn2 A C 12: 116,722,172 T84P possibly damaging Het
Rln1 C T 19: 29,332,068 E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 S271P probably damaging Het
Rngtt A G 4: 33,368,660 T398A probably benign Het
Rprd2 G T 3: 95,764,803 T1096K probably damaging Het
Sema3e C T 5: 14,162,185 probably benign Het
Sema5a T A 15: 32,548,799 C140S probably damaging Het
Shpk A C 11: 73,222,931 D390A probably benign Het
Slc22a20 C T 19: 5,972,848 probably benign Het
Steap2 A G 5: 5,677,393 V314A possibly damaging Het
Stxbp5l A G 16: 37,290,927 probably null Het
Tgm3 G T 2: 130,041,768 E449* probably null Het
Tmem68 A C 4: 3,560,627 L186V probably damaging Het
Ttc41 T A 10: 86,776,252 W1130R possibly damaging Het
Ttpal T C 2: 163,615,366 F253L possibly damaging Het
Vmn2r99 G T 17: 19,362,252 V40F probably benign Het
Xkr9 G A 1: 13,700,943 V228M probably damaging Het
Zc3h7b C T 15: 81,777,067 A369V probably benign Het
Other mutations in Cspg4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Cspg4 APN 9 56898865 missense probably damaging 1.00
IGL01322:Cspg4 APN 9 56898588 missense probably damaging 1.00
IGL01922:Cspg4 APN 9 56887887 missense probably damaging 1.00
IGL01993:Cspg4 APN 9 56898478 missense probably benign 0.09
IGL02379:Cspg4 APN 9 56892609 splice site probably benign
IGL02398:Cspg4 APN 9 56886686 missense probably benign 0.43
IGL02503:Cspg4 APN 9 56897403 missense probably damaging 1.00
IGL02504:Cspg4 APN 9 56885772 missense probably benign 0.06
IGL02692:Cspg4 APN 9 56887454 missense probably benign 0.00
IGL02728:Cspg4 APN 9 56886481 missense probably damaging 1.00
IGL02806:Cspg4 APN 9 56890259 missense possibly damaging 0.57
IGL02886:Cspg4 APN 9 56897388 missense probably damaging 0.99
IGL03005:Cspg4 APN 9 56888488 missense probably damaging 1.00
IGL03008:Cspg4 APN 9 56898475 missense possibly damaging 0.48
IGL03202:Cspg4 APN 9 56897739 missense possibly damaging 0.93
chiclets UTSW 9 56885222 splice site probably null
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0066:Cspg4 UTSW 9 56888134 missense probably damaging 1.00
R0254:Cspg4 UTSW 9 56897410 missense probably damaging 0.98
R0284:Cspg4 UTSW 9 56886139 missense probably damaging 0.96
R0513:Cspg4 UTSW 9 56898091 missense probably benign 0.03
R0602:Cspg4 UTSW 9 56888017 missense probably damaging 1.00
R0747:Cspg4 UTSW 9 56890280 missense probably damaging 1.00
R1005:Cspg4 UTSW 9 56888736 missense probably benign 0.13
R1421:Cspg4 UTSW 9 56896626 missense probably benign 0.00
R1443:Cspg4 UTSW 9 56886512 missense probably damaging 1.00
R1481:Cspg4 UTSW 9 56887810 missense probably damaging 0.98
R1585:Cspg4 UTSW 9 56898867 missense probably damaging 0.99
R1624:Cspg4 UTSW 9 56888470 missense probably damaging 1.00
R1721:Cspg4 UTSW 9 56888743 missense probably damaging 0.98
R1728:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1729:Cspg4 UTSW 9 56898537 missense probably benign 0.00
R1763:Cspg4 UTSW 9 56886979 missense probably damaging 0.97
R1772:Cspg4 UTSW 9 56897492 missense probably benign 0.02
R1938:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R1975:Cspg4 UTSW 9 56890478 missense probably damaging 1.00
R2064:Cspg4 UTSW 9 56896656 missense probably damaging 1.00
R2185:Cspg4 UTSW 9 56886972 missense probably benign 0.37
R2252:Cspg4 UTSW 9 56898046 missense probably damaging 1.00
R2291:Cspg4 UTSW 9 56892743 missense probably damaging 0.96
R2329:Cspg4 UTSW 9 56888550 missense probably benign 0.00
R3780:Cspg4 UTSW 9 56888233 missense probably damaging 1.00
R3830:Cspg4 UTSW 9 56897621 missense probably damaging 0.99
R3944:Cspg4 UTSW 9 56886123 missense probably damaging 1.00
R4011:Cspg4 UTSW 9 56887317 missense probably benign 0.19
R4115:Cspg4 UTSW 9 56898394 missense probably damaging 1.00
R4173:Cspg4 UTSW 9 56887930 missense probably damaging 1.00
R4243:Cspg4 UTSW 9 56887857 missense probably benign 0.12
R4329:Cspg4 UTSW 9 56892465 missense probably damaging 0.99
R4544:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4545:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4546:Cspg4 UTSW 9 56888629 missense possibly damaging 0.79
R4649:Cspg4 UTSW 9 56886865 missense possibly damaging 0.93
R4663:Cspg4 UTSW 9 56886676 missense possibly damaging 0.61
R4674:Cspg4 UTSW 9 56898205 missense probably damaging 1.00
R4779:Cspg4 UTSW 9 56885808 missense probably damaging 1.00
R4884:Cspg4 UTSW 9 56898069 missense probably benign 0.00
R5021:Cspg4 UTSW 9 56897730 missense probably benign 0.01
R5051:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
R5328:Cspg4 UTSW 9 56885856 missense probably benign 0.01
R5394:Cspg4 UTSW 9 56890200 missense probably damaging 1.00
R5567:Cspg4 UTSW 9 56886648 missense probably benign 0.00
R5682:Cspg4 UTSW 9 56886196 missense probably benign 0.14
R5690:Cspg4 UTSW 9 56898735 missense probably benign 0.01
R5715:Cspg4 UTSW 9 56891051 missense possibly damaging 0.90
R5717:Cspg4 UTSW 9 56885798 missense probably benign
R5726:Cspg4 UTSW 9 56885904 missense probably damaging 1.00
R5898:Cspg4 UTSW 9 56885222 splice site probably null
R6140:Cspg4 UTSW 9 56897224 missense probably benign 0.35
R6147:Cspg4 UTSW 9 56888772 missense probably damaging 0.99
R6239:Cspg4 UTSW 9 56888182 missense probably benign 0.04
R6343:Cspg4 UTSW 9 56892692 missense probably benign
R6351:Cspg4 UTSW 9 56892644 missense probably benign 0.00
R6564:Cspg4 UTSW 9 56890158 missense probably benign 0.02
R6814:Cspg4 UTSW 9 56890340 missense possibly damaging 0.91
R6928:Cspg4 UTSW 9 56897880 missense possibly damaging 0.95
R6967:Cspg4 UTSW 9 56890136 missense possibly damaging 0.52
R6981:Cspg4 UTSW 9 56887101 missense probably benign 0.00
R7033:Cspg4 UTSW 9 56888074 missense probably damaging 0.96
X0065:Cspg4 UTSW 9 56885736 missense possibly damaging 0.95
Z1088:Cspg4 UTSW 9 56886036 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGTCGGCATGATGTACTCTTCCAG -3'
(R):5'- GTGTGAAGTGAGTCACAGGTCCAG -3'

Sequencing Primer
(F):5'- GATGTACTCTTCCAGGTCACACAG -3'
(R):5'- AGTCACAGGTCCAGTGTTGTC -3'
Posted On2014-05-09