Incidental Mutation 'R1670:Stxbp5l'
ID187578
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Namesyntaxin binding protein 5-like
Synonymst2md1, insulin level locus 1, tomosyn-2, T2dm1, A830015P08Rik, LLGL4
MMRRC Submission 039706-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1670 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location37114942-37384962 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 37290927 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114775
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114780
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.466 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402H24Rik G A 2: 130,712,379 P187S probably damaging Het
Abcc9 A G 6: 142,594,722 V1497A possibly damaging Het
Adam15 T C 3: 89,348,510 probably benign Het
Angel2 T A 1: 190,942,163 S371T probably benign Het
Atr T A 9: 95,861,456 N49K probably benign Het
Bace2 G A 16: 97,412,135 M228I probably damaging Het
Bdp1 A C 13: 100,027,433 probably null Het
Calr A T 8: 84,844,119 D302E probably benign Het
Camta1 T C 4: 151,079,771 D340G probably benign Het
Car11 C T 7: 45,703,525 T236I possibly damaging Het
Cfap69 A T 5: 5,586,409 S275T probably benign Het
Cib2 G A 9: 54,548,369 R104W probably damaging Het
CN725425 T C 15: 91,245,815 S294P possibly damaging Het
Coro7 G A 16: 4,628,233 S876F possibly damaging Het
Cspg4 G A 9: 56,897,403 V1833M probably damaging Het
Dennd6b C A 15: 89,185,337 probably benign Het
Dhx30 A T 9: 110,085,273 Y979N possibly damaging Het
Dnah8 A T 17: 30,725,124 I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 I3976N possibly damaging Het
Ebi3 T C 17: 55,954,479 I125T probably damaging Het
Elfn2 C T 15: 78,672,368 A660T probably benign Het
F12 C T 13: 55,421,533 C209Y probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fam126a T A 5: 23,999,991 M1L possibly damaging Het
Fgfr2 T A 7: 130,180,457 D413V probably damaging Het
Gdf10 T A 14: 33,932,043 I169N possibly damaging Het
Gdnf T C 15: 7,815,649 V41A probably benign Het
Gm9857 A T 3: 108,940,162 probably benign Het
Gpatch11 A G 17: 78,839,100 E58G possibly damaging Het
Gpr55 A G 1: 85,941,415 V148A possibly damaging Het
Gucy1b1 A G 3: 82,045,460 I222T probably benign Het
Hnf4a T C 2: 163,562,576 S227P probably damaging Het
Hsfy2 A G 1: 56,636,389 S330P possibly damaging Het
Ift122 T C 6: 115,923,883 V1054A probably benign Het
Il27 T A 7: 126,589,475 E175D probably benign Het
Lactb2 A T 1: 13,660,417 S12T probably damaging Het
Lrfn2 T C 17: 49,096,577 V576A probably benign Het
Mansc4 C G 6: 147,075,191 R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,275,958 probably benign Het
Mrpl16 C T 19: 11,774,595 R240* probably null Het
Muc3 A G 5: 137,143,995 V70A probably benign Het
Ndnf A G 6: 65,703,070 D111G probably benign Het
Nek4 T C 14: 30,982,427 F688S probably damaging Het
Nkx2-6 T A 14: 69,174,677 M98K probably benign Het
Nup188 T C 2: 30,340,655 S1402P probably benign Het
Olfr1036 T A 2: 86,075,250 V170D probably benign Het
Olfr1307 C T 2: 111,944,919 C179Y probably damaging Het
Olfr205 A T 16: 59,329,244 N88K probably benign Het
Olfr206 T C 16: 59,345,427 I91M possibly damaging Het
Olfr330 A T 11: 58,529,411 S192T probably damaging Het
Olfr418 T A 1: 173,270,900 S242T probably damaging Het
Olfr556 A G 7: 102,670,402 T161A possibly damaging Het
Parp10 A T 15: 76,242,070 V306E probably benign Het
Pcnx3 A G 19: 5,673,315 L1284P probably damaging Het
Pld1 A T 3: 28,049,240 I365F probably benign Het
Pnisr A G 4: 21,865,893 D294G probably damaging Het
Pogz C T 3: 94,878,849 T863I probably benign Het
Ptprn2 A C 12: 116,722,172 T84P possibly damaging Het
Rln1 C T 19: 29,332,068 E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 S271P probably damaging Het
Rngtt A G 4: 33,368,660 T398A probably benign Het
Rprd2 G T 3: 95,764,803 T1096K probably damaging Het
Sema3e C T 5: 14,162,185 probably benign Het
Sema5a T A 15: 32,548,799 C140S probably damaging Het
Shpk A C 11: 73,222,931 D390A probably benign Het
Slc22a20 C T 19: 5,972,848 probably benign Het
Steap2 A G 5: 5,677,393 V314A possibly damaging Het
Tgm3 G T 2: 130,041,768 E449* probably null Het
Tmem68 A C 4: 3,560,627 L186V probably damaging Het
Ttc41 T A 10: 86,776,252 W1130R possibly damaging Het
Ttpal T C 2: 163,615,366 F253L possibly damaging Het
Vmn2r99 G T 17: 19,362,252 V40F probably benign Het
Xkr9 G A 1: 13,700,943 V228M probably damaging Het
Zc3h7b C T 15: 81,777,067 A369V probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37208100 missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37204578 missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37215979 missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37345092 missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37200592 missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37329895 missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37208205 missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37186654 nonsense probably null
IGL03125:Stxbp5l APN 16 37186721 missense probably benign 0.02
R0058:Stxbp5l UTSW 16 37142374 missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37288308 missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37216078 splice site probably benign
R0454:Stxbp5l UTSW 16 37134284 missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 37129797 critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37208096 missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37204521 missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 37142432 missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37247869 critical splice donor site probably null
R1593:Stxbp5l UTSW 16 37116052 missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37208111 missense probably benign 0.34
R2077:Stxbp5l UTSW 16 37236275 missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37216036 missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 37115667 missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37208186 missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37200642 nonsense probably null
R2918:Stxbp5l UTSW 16 37200642 nonsense probably null
R2935:Stxbp5l UTSW 16 37134189 missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37241346 nonsense probably null
R3694:Stxbp5l UTSW 16 37241346 nonsense probably null
R3695:Stxbp5l UTSW 16 37241346 nonsense probably null
R4133:Stxbp5l UTSW 16 37208119 missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37247880 missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37255884 missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37188634 missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 37134230 missense probably benign 0.18
R5105:Stxbp5l UTSW 16 37142372 missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37186654 missense probably benign 0.19
R5358:Stxbp5l UTSW 16 37174326 missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 37129851 missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37208097 missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 37129815 missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37204448 missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37188629 missense possibly damaging 0.94
Z1088:Stxbp5l UTSW 16 37204489 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGGTTGGGAGAATAAAATCTGGAGT -3'
(R):5'- ACCACTTACTAATGCTGGAAGCAAAGG -3'

Sequencing Primer
(F):5'- GCTGTTTTGCCACTTAAAGATGATG -3'
(R):5'- CGAAATGCTCTCTCGGTACATAG -3'
Posted On2014-05-09