Incidental Mutation 'R1670:Stxbp5l'
ID 187578
Institutional Source Beutler Lab
Gene Symbol Stxbp5l
Ensembl Gene ENSMUSG00000022829
Gene Name syntaxin binding protein 5-like
Synonyms insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik
MMRRC Submission 039706-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1670 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 36935304-37205324 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 37111289 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110435 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114775] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]
AlphaFold Q5DQR4
Predicted Effect noncoding transcript
Transcript: ENSMUST00000023526
SMART Domains Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 2e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 7.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
low complexity region 790 804 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114775
SMART Domains Protein: ENSMUSP00000110423
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 3.5e-45 PFAM
Blast:WD40 397 466 6e-43 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000114780
SMART Domains Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.6e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 731 988 3e-9 PFAM
PDB:1URQ|A 1038 1097 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114781
SMART Domains Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 8.9e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 755 1012 3.1e-9 PFAM
PDB:1URQ|A 1062 1121 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114782
SMART Domains Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 284 396 9.2e-45 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 785 1045 3.1e-9 PFAM
PDB:1URQ|A 1095 1154 2e-25 PDB
Predicted Effect probably null
Transcript: ENSMUST00000114787
SMART Domains Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829

DomainStartEndE-ValueType
low complexity region 16 40 N/A INTRINSIC
WD40 58 97 1.1e2 SMART
WD40 99 138 6.66e-1 SMART
Blast:WD40 143 182 1e-20 BLAST
WD40 197 236 2.22e0 SMART
WD40 240 277 1.7e-2 SMART
Pfam:LLGL 287 396 8.7e-35 PFAM
WD40 397 476 7.7e-1 SMART
WD40 501 541 6.14e1 SMART
low complexity region 577 592 N/A INTRINSIC
Pfam:Lgl_C 811 1069 3.3e-9 PFAM
PDB:1URQ|A 1119 1178 2e-25 PDB
Meta Mutation Damage Score 0.9494 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.3%
  • 20x: 92.3%
Validation Efficiency 97% (74/76)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,540,448 (GRCm39) V1497A possibly damaging Het
Adam15 T C 3: 89,255,817 (GRCm39) probably benign Het
Angel2 T A 1: 190,674,360 (GRCm39) S371T probably benign Het
Atr T A 9: 95,743,509 (GRCm39) N49K probably benign Het
Bace2 G A 16: 97,213,335 (GRCm39) M228I probably damaging Het
Bdp1 A C 13: 100,163,941 (GRCm39) probably null Het
Calr A T 8: 85,570,748 (GRCm39) D302E probably benign Het
Camta1 T C 4: 151,164,228 (GRCm39) D340G probably benign Het
Car11 C T 7: 45,352,949 (GRCm39) T236I possibly damaging Het
Cfap69 A T 5: 5,636,409 (GRCm39) S275T probably benign Het
Cib2 G A 9: 54,455,653 (GRCm39) R104W probably damaging Het
CN725425 T C 15: 91,130,018 (GRCm39) S294P possibly damaging Het
Coro7 G A 16: 4,446,097 (GRCm39) S876F possibly damaging Het
Cspg4 G A 9: 56,804,687 (GRCm39) V1833M probably damaging Het
Dennd6b C A 15: 89,069,540 (GRCm39) probably benign Het
Dhx30 A T 9: 109,914,341 (GRCm39) Y979N possibly damaging Het
Dnaaf9 G A 2: 130,554,299 (GRCm39) P187S probably damaging Het
Dnah8 A T 17: 30,944,098 (GRCm39) I1772F probably damaging Het
Dync2h1 A T 9: 6,993,942 (GRCm39) I3976N possibly damaging Het
Ebi3 T C 17: 56,261,479 (GRCm39) I125T probably damaging Het
Elfn2 C T 15: 78,556,568 (GRCm39) A660T probably benign Het
F12 C T 13: 55,569,346 (GRCm39) C209Y probably damaging Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fgfr2 T A 7: 129,782,187 (GRCm39) D413V probably damaging Het
Gdf10 T A 14: 33,654,000 (GRCm39) I169N possibly damaging Het
Gdnf T C 15: 7,845,130 (GRCm39) V41A probably benign Het
Gm9857 A T 3: 108,847,478 (GRCm39) probably benign Het
Gpatch11 A G 17: 79,146,529 (GRCm39) E58G possibly damaging Het
Gpr55 A G 1: 85,869,137 (GRCm39) V148A possibly damaging Het
Gucy1b1 A G 3: 81,952,767 (GRCm39) I222T probably benign Het
Hnf4a T C 2: 163,404,496 (GRCm39) S227P probably damaging Het
Hsfy2 A G 1: 56,675,548 (GRCm39) S330P possibly damaging Het
Hycc1 T A 5: 24,204,989 (GRCm39) M1L possibly damaging Het
Ift122 T C 6: 115,900,844 (GRCm39) V1054A probably benign Het
Il27 T A 7: 126,188,647 (GRCm39) E175D probably benign Het
Lactb2 A T 1: 13,730,641 (GRCm39) S12T probably damaging Het
Lrfn2 T C 17: 49,403,605 (GRCm39) V576A probably benign Het
Mansc4 C G 6: 146,976,689 (GRCm39) R309T possibly damaging Het
Med12l AACAGCA AACAGCAACAGCA 3: 59,183,379 (GRCm39) probably benign Het
Mrpl16 C T 19: 11,751,959 (GRCm39) R240* probably null Het
Muc17 A G 5: 137,172,843 (GRCm39) V70A probably benign Het
Ndnf A G 6: 65,680,054 (GRCm39) D111G probably benign Het
Nek4 T C 14: 30,704,384 (GRCm39) F688S probably damaging Het
Nkx2-6 T A 14: 69,412,126 (GRCm39) M98K probably benign Het
Nup188 T C 2: 30,230,667 (GRCm39) S1402P probably benign Het
Or10j2 T A 1: 173,098,467 (GRCm39) S242T probably damaging Het
Or2t48 A T 11: 58,420,237 (GRCm39) S192T probably damaging Het
Or4f14b C T 2: 111,775,264 (GRCm39) C179Y probably damaging Het
Or52i2 A G 7: 102,319,609 (GRCm39) T161A possibly damaging Het
Or5ac23 A T 16: 59,149,607 (GRCm39) N88K probably benign Het
Or5ac24 T C 16: 59,165,790 (GRCm39) I91M possibly damaging Het
Or5m9b T A 2: 85,905,594 (GRCm39) V170D probably benign Het
Parp10 A T 15: 76,126,270 (GRCm39) V306E probably benign Het
Pcnx3 A G 19: 5,723,343 (GRCm39) L1284P probably damaging Het
Pld1 A T 3: 28,103,389 (GRCm39) I365F probably benign Het
Pnisr A G 4: 21,865,893 (GRCm39) D294G probably damaging Het
Pogz C T 3: 94,786,160 (GRCm39) T863I probably benign Het
Ptprn2 A C 12: 116,685,792 (GRCm39) T84P possibly damaging Het
Rln1 C T 19: 29,309,468 (GRCm39) E104K possibly damaging Het
Rnf38 A G 4: 44,138,681 (GRCm39) S271P probably damaging Het
Rngtt A G 4: 33,368,660 (GRCm39) T398A probably benign Het
Rprd2 G T 3: 95,672,115 (GRCm39) T1096K probably damaging Het
Sema3e C T 5: 14,212,199 (GRCm39) probably benign Het
Sema5a T A 15: 32,548,945 (GRCm39) C140S probably damaging Het
Shpk A C 11: 73,113,757 (GRCm39) D390A probably benign Het
Slc22a20 C T 19: 6,022,876 (GRCm39) probably benign Het
Steap2 A G 5: 5,727,393 (GRCm39) V314A possibly damaging Het
Tgm3 G T 2: 129,883,688 (GRCm39) E449* probably null Het
Tmem68 A C 4: 3,560,627 (GRCm39) L186V probably damaging Het
Ttc41 T A 10: 86,612,116 (GRCm39) W1130R possibly damaging Het
Ttpal T C 2: 163,457,286 (GRCm39) F253L possibly damaging Het
Vmn2r99 G T 17: 19,582,514 (GRCm39) V40F probably benign Het
Xkr9 G A 1: 13,771,167 (GRCm39) V228M probably damaging Het
Zc3h7b C T 15: 81,661,268 (GRCm39) A369V probably benign Het
Other mutations in Stxbp5l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Stxbp5l APN 16 37,028,462 (GRCm39) missense possibly damaging 0.82
IGL01082:Stxbp5l APN 16 37,024,940 (GRCm39) missense possibly damaging 0.89
IGL01448:Stxbp5l APN 16 37,036,341 (GRCm39) missense probably damaging 0.99
IGL01475:Stxbp5l APN 16 37,165,454 (GRCm39) missense possibly damaging 0.95
IGL01899:Stxbp5l APN 16 37,020,954 (GRCm39) missense probably benign 0.19
IGL02232:Stxbp5l APN 16 37,150,257 (GRCm39) missense probably damaging 1.00
IGL02389:Stxbp5l APN 16 37,028,567 (GRCm39) missense probably benign 0.00
IGL02745:Stxbp5l APN 16 37,007,016 (GRCm39) nonsense probably null
IGL03125:Stxbp5l APN 16 37,007,083 (GRCm39) missense probably benign 0.02
R0058:Stxbp5l UTSW 16 36,962,736 (GRCm39) missense possibly damaging 0.76
R0345:Stxbp5l UTSW 16 37,108,670 (GRCm39) missense probably damaging 1.00
R0359:Stxbp5l UTSW 16 37,036,440 (GRCm39) splice site probably benign
R0454:Stxbp5l UTSW 16 36,954,646 (GRCm39) missense possibly damaging 0.94
R0525:Stxbp5l UTSW 16 36,950,159 (GRCm39) critical splice donor site probably null
R0543:Stxbp5l UTSW 16 37,028,458 (GRCm39) missense probably damaging 1.00
R0606:Stxbp5l UTSW 16 37,024,883 (GRCm39) missense possibly damaging 0.46
R0607:Stxbp5l UTSW 16 36,962,794 (GRCm39) missense probably benign 0.00
R1333:Stxbp5l UTSW 16 37,068,231 (GRCm39) critical splice donor site probably null
R1593:Stxbp5l UTSW 16 36,936,414 (GRCm39) missense probably damaging 0.96
R1605:Stxbp5l UTSW 16 37,028,473 (GRCm39) missense probably benign 0.34
R2077:Stxbp5l UTSW 16 37,056,637 (GRCm39) missense possibly damaging 0.93
R2209:Stxbp5l UTSW 16 37,036,398 (GRCm39) missense probably damaging 0.98
R2504:Stxbp5l UTSW 16 36,936,029 (GRCm39) missense probably damaging 1.00
R2909:Stxbp5l UTSW 16 37,028,548 (GRCm39) missense possibly damaging 0.89
R2917:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2918:Stxbp5l UTSW 16 37,021,004 (GRCm39) nonsense probably null
R2935:Stxbp5l UTSW 16 36,954,551 (GRCm39) missense possibly damaging 0.76
R3693:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3694:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R3695:Stxbp5l UTSW 16 37,061,708 (GRCm39) nonsense probably null
R4133:Stxbp5l UTSW 16 37,028,481 (GRCm39) missense possibly damaging 0.80
R4180:Stxbp5l UTSW 16 37,068,242 (GRCm39) missense probably benign 0.05
R4676:Stxbp5l UTSW 16 37,076,246 (GRCm39) missense probably damaging 1.00
R4757:Stxbp5l UTSW 16 37,008,996 (GRCm39) missense probably damaging 1.00
R4758:Stxbp5l UTSW 16 36,954,592 (GRCm39) missense probably benign 0.18
R5105:Stxbp5l UTSW 16 36,962,734 (GRCm39) missense probably benign 0.43
R5278:Stxbp5l UTSW 16 37,007,016 (GRCm39) missense probably benign 0.19
R5358:Stxbp5l UTSW 16 36,994,688 (GRCm39) missense probably damaging 0.99
R5411:Stxbp5l UTSW 16 36,950,213 (GRCm39) missense probably damaging 1.00
R5773:Stxbp5l UTSW 16 37,028,459 (GRCm39) missense probably damaging 1.00
R6539:Stxbp5l UTSW 16 36,950,177 (GRCm39) missense probably damaging 1.00
R6869:Stxbp5l UTSW 16 37,024,810 (GRCm39) missense possibly damaging 0.74
R6892:Stxbp5l UTSW 16 37,008,991 (GRCm39) missense possibly damaging 0.94
R7369:Stxbp5l UTSW 16 36,954,703 (GRCm39) missense probably benign 0.12
R7555:Stxbp5l UTSW 16 37,143,965 (GRCm39) missense probably damaging 1.00
R7657:Stxbp5l UTSW 16 37,030,534 (GRCm39) missense probably null 0.21
R8171:Stxbp5l UTSW 16 37,028,416 (GRCm39) missense noncoding transcript
R8338:Stxbp5l UTSW 16 36,994,718 (GRCm39) missense probably damaging 1.00
R8732:Stxbp5l UTSW 16 37,061,809 (GRCm39) missense probably benign
R8833:Stxbp5l UTSW 16 37,024,814 (GRCm39) missense probably benign 0.44
R8883:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8898:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8899:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8906:Stxbp5l UTSW 16 37,028,526 (GRCm39) missense probably damaging 1.00
R8918:Stxbp5l UTSW 16 36,954,892 (GRCm39) missense
R8959:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8961:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R8989:Stxbp5l UTSW 16 37,036,414 (GRCm39) frame shift probably null
R9027:Stxbp5l UTSW 16 37,165,473 (GRCm39) missense probably damaging 1.00
R9044:Stxbp5l UTSW 16 37,024,930 (GRCm39) missense possibly damaging 0.77
R9226:Stxbp5l UTSW 16 37,076,206 (GRCm39) missense probably damaging 0.96
R9284:Stxbp5l UTSW 16 37,028,442 (GRCm39) nonsense probably null
R9351:Stxbp5l UTSW 16 36,936,047 (GRCm39) missense probably damaging 1.00
R9425:Stxbp5l UTSW 16 36,994,706 (GRCm39) missense possibly damaging 0.83
R9545:Stxbp5l UTSW 16 37,028,625 (GRCm39) critical splice acceptor site probably null
R9567:Stxbp5l UTSW 16 37,061,734 (GRCm39) missense probably benign 0.37
R9616:Stxbp5l UTSW 16 37,036,314 (GRCm39) missense probably damaging 1.00
R9781:Stxbp5l UTSW 16 37,165,485 (GRCm39) missense probably benign 0.38
Z1088:Stxbp5l UTSW 16 37,024,851 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CCAGGGTTGGGAGAATAAAATCTGGAGT -3'
(R):5'- ACCACTTACTAATGCTGGAAGCAAAGG -3'

Sequencing Primer
(F):5'- GCTGTTTTGCCACTTAAAGATGATG -3'
(R):5'- CGAAATGCTCTCTCGGTACATAG -3'
Posted On 2014-05-09