Incidental Mutation 'R1671:Tank'
ID187597
Institutional Source Beutler Lab
Gene Symbol Tank
Ensembl Gene ENSMUSG00000064289
Gene NameTRAF family member-associated Nf-kappa B activator
SynonymsE430026L09Rik, I-TRAF
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.701) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location61578585-61654171 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 61649753 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 211 (V211E)
Ref Sequence ENSEMBL: ENSMUSP00000108121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078074] [ENSMUST00000112494] [ENSMUST00000112495] [ENSMUST00000112501] [ENSMUST00000112502]
Predicted Effect probably damaging
Transcript: ENSMUST00000078074
AA Change: V212E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000077219
Gene: ENSMUSG00000064289
AA Change: V212E

DomainStartEndE-ValueType
coiled coil region 60 98 N/A INTRINSIC
Pfam:TBD 165 219 1.2e-27 PFAM
ZnF_C2H2 417 443 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112494
AA Change: V177E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108113
Gene: ENSMUSG00000064289
AA Change: V177E

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 5.9e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000112495
AA Change: V177E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000108114
Gene: ENSMUSG00000064289
AA Change: V177E

DomainStartEndE-ValueType
coiled coil region 22 63 N/A INTRINSIC
Pfam:TBD 128 184 1.3e-33 PFAM
ZnF_C2H2 382 408 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112501
AA Change: V178E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108120
Gene: ENSMUSG00000064289
AA Change: V178E

DomainStartEndE-ValueType
coiled coil region 26 64 N/A INTRINSIC
Pfam:TBD 129 185 1.3e-33 PFAM
ZnF_C2H2 383 409 1.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112502
AA Change: V211E

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000108121
Gene: ENSMUSG00000064289
AA Change: V211E

DomainStartEndE-ValueType
coiled coil region 56 97 N/A INTRINSIC
Pfam:TBD 162 218 8.2e-34 PFAM
ZnF_C2H2 416 442 1.81e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141544
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143515
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154693
Meta Mutation Damage Score 0.276 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The TRAF (tumor necrosis factor receptor-associated factor) family of proteins associate with and transduce signals from members of the tumor necrosis factor receptor superfamily. The protein encoded by this gene is found in the cytoplasm and can bind to TRAF1, TRAF2, or TRAF3, thereby inhibiting TRAF function by sequestering the TRAFs in a latent state in the cytoplasm. For example, the protein encoded by this gene can block TRAF2 binding to LMP1, the Epstein-Barr virus transforming protein, and inhibit LMP1-mediated NF-kappa-B activation. Three alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mice develop fatal glomerulonephritis owing to deposition of immune complexes. Dendritic cells, macrophages and B cells from these mice are hyper-responsive to stimuli leading to increased production of immunoglobulins and inflammatory cytokines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Tank
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02994:Tank APN 2 61650292 splice site probably benign
malade UTSW 2 61644424 critical splice donor site probably null
R1620:Tank UTSW 2 61650098 missense possibly damaging 0.92
R1862:Tank UTSW 2 61649912 missense probably damaging 1.00
R3918:Tank UTSW 2 61643786 critical splice donor site probably null
R4714:Tank UTSW 2 61650229 missense probably benign 0.01
R4727:Tank UTSW 2 61653532 missense probably benign 0.05
R4865:Tank UTSW 2 61578635 start gained probably benign
R4867:Tank UTSW 2 61578635 start gained probably benign
R5023:Tank UTSW 2 61578635 start gained probably benign
R5213:Tank UTSW 2 61649948 missense probably benign 0.01
R5562:Tank UTSW 2 61650208 missense possibly damaging 0.59
R5950:Tank UTSW 2 61653569 utr 3 prime probably benign
R6221:Tank UTSW 2 61650083 missense probably damaging 1.00
R6626:Tank UTSW 2 61650296 splice site probably benign
R6670:Tank UTSW 2 61644424 critical splice donor site probably null
R6850:Tank UTSW 2 61650002 missense probably benign 0.19
R7027:Tank UTSW 2 61653422 missense probably benign 0.00
R7478:Tank UTSW 2 61650169 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAGCCTGTACACTGTGCTC -3'
(R):5'- AAATCGGTCCTGGCACACTGTCTC -3'

Sequencing Primer
(F):5'- CTGCTGTTATCCTCAGGGAAGAC -3'
(R):5'- CATTGTCCATAGGCGGAAACTTG -3'
Posted On2014-05-09