Incidental Mutation 'R1671:Gucy1a1'
ID187601
Institutional Source Beutler Lab
Gene Symbol Gucy1a1
Ensembl Gene ENSMUSG00000033910
Gene Nameguanylate cyclase 1, soluble, alpha 1
SynonymssGC-alpha1, alpha 1 sGC, 1200016O07Rik
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location82092427-82145789 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 82106222 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Serine at position 371 (I371S)
Ref Sequence ENSEMBL: ENSMUSP00000142138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048976] [ENSMUST00000193924]
Predicted Effect probably damaging
Transcript: ENSMUST00000048976
AA Change: I371S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000048918
Gene: ENSMUSG00000033910
AA Change: I371S

DomainStartEndE-ValueType
Pfam:HNOB 85 235 2.5e-8 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183464
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191942
Predicted Effect probably benign
Transcript: ENSMUST00000192289
Predicted Effect probably damaging
Transcript: ENSMUST00000193924
AA Change: I371S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142138
Gene: ENSMUSG00000033910
AA Change: I371S

DomainStartEndE-ValueType
Pfam:HNOB 73 237 1.6e-7 PFAM
PDB:4GJ4|D 277 403 1e-18 PDB
CYCc 445 636 4.71e-103 SMART
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Soluble guanylate cyclases are heterodimeric proteins that catalyze the conversion of GTP to 3',5'-cyclic GMP and pyrophosphate. The protein encoded by this gene is an alpha subunit of this complex and it interacts with a beta subunit to form the guanylate cyclase enzyme, which is activated by nitric oxide. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a null mutation display mild elevation of systolic blood pressure, and abnormal blood vessel and platelet responses to NO. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Gucy1a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00951:Gucy1a1 APN 3 82111191 missense probably benign 0.00
IGL01626:Gucy1a1 APN 3 82108619 missense probably damaging 1.00
IGL01662:Gucy1a1 APN 3 82109253 missense possibly damaging 0.63
IGL02480:Gucy1a1 APN 3 82097733 missense probably damaging 1.00
IGL02902:Gucy1a1 APN 3 82118917 missense possibly damaging 0.87
IGL03022:Gucy1a1 APN 3 82109097 missense probably benign 0.30
IGL03056:Gucy1a1 APN 3 82113287 missense probably benign 0.00
IGL03089:Gucy1a1 APN 3 82097681 missense probably damaging 1.00
IGL03226:Gucy1a1 APN 3 82119024 missense probably benign 0.00
IGL03377:Gucy1a1 APN 3 82106015 missense probably damaging 1.00
R0245:Gucy1a1 UTSW 3 82108787 missense possibly damaging 0.67
R0762:Gucy1a1 UTSW 3 82094896 missense unknown
R0907:Gucy1a1 UTSW 3 82111191 missense probably benign 0.00
R1242:Gucy1a1 UTSW 3 82105953 unclassified probably null
R1625:Gucy1a1 UTSW 3 82102055 missense probably benign 0.02
R2056:Gucy1a1 UTSW 3 82109285 missense possibly damaging 0.89
R2094:Gucy1a1 UTSW 3 82113332 missense probably benign
R2140:Gucy1a1 UTSW 3 82118886 splice site probably null
R2154:Gucy1a1 UTSW 3 82111151 critical splice donor site probably null
R3418:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R3419:Gucy1a1 UTSW 3 82106133 missense probably damaging 1.00
R4290:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4291:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4292:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4294:Gucy1a1 UTSW 3 82094759 missense possibly damaging 0.95
R4573:Gucy1a1 UTSW 3 82108922 missense possibly damaging 0.95
R4629:Gucy1a1 UTSW 3 82097624 missense probably damaging 1.00
R4755:Gucy1a1 UTSW 3 82094795 missense probably benign 0.40
R4865:Gucy1a1 UTSW 3 82119162 utr 5 prime probably benign
R5528:Gucy1a1 UTSW 3 82109073 missense probably damaging 1.00
R5933:Gucy1a1 UTSW 3 82094807 missense probably damaging 0.96
R6278:Gucy1a1 UTSW 3 82097634 missense probably damaging 1.00
R6385:Gucy1a1 UTSW 3 82109006 missense probably benign
R7011:Gucy1a1 UTSW 3 82109115 missense probably damaging 1.00
R7361:Gucy1a1 UTSW 3 82097720 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGCACAGCAGATCCACTGTCC -3'
(R):5'- AATTTGGCAGGCAACAGCACCC -3'

Sequencing Primer
(F):5'- AGGGTTGCCTTCAGCTTC -3'
(R):5'- GGCCTTAGAACAAGGACTGTTTC -3'
Posted On2014-05-09