Incidental Mutation 'R1671:Xpo6'
ID187613
Institutional Source Beutler Lab
Gene Symbol Xpo6
Ensembl Gene ENSMUSG00000000131
Gene Nameexportin 6
Synonyms2610005L19Rik, C230091E20Rik, Ranbp20
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location126101715-126200501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 126108543 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 897 (V897A)
Ref Sequence ENSEMBL: ENSMUSP00000009344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009344] [ENSMUST00000165608] [ENSMUST00000166538] [ENSMUST00000166719] [ENSMUST00000168189] [ENSMUST00000171861]
Predicted Effect possibly damaging
Transcript: ENSMUST00000009344
AA Change: V897A

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000009344
Gene: ENSMUSG00000000131
AA Change: V897A

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.4e-29 PFAM
low complexity region 469 484 N/A INTRINSIC
low complexity region 672 684 N/A INTRINSIC
low complexity region 1022 1034 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165608
Predicted Effect unknown
Transcript: ENSMUST00000165660
AA Change: V127A
Predicted Effect probably benign
Transcript: ENSMUST00000166538
Predicted Effect probably benign
Transcript: ENSMUST00000166719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167315
Predicted Effect possibly damaging
Transcript: ENSMUST00000168189
AA Change: V898A

PolyPhen 2 Score 0.862 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000130527
Gene: ENSMUSG00000000131
AA Change: V898A

DomainStartEndE-ValueType
IBN_N 31 97 4.04e-6 SMART
Pfam:Xpo1 103 290 1.1e-25 PFAM
low complexity region 469 485 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 1023 1035 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168564
SMART Domains Protein: ENSMUSP00000129881
Gene: ENSMUSG00000000131

DomainStartEndE-ValueType
low complexity region 61 73 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168933
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170675
Predicted Effect probably benign
Transcript: ENSMUST00000171861
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Xpo6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Xpo6 APN 7 126129568 missense probably benign 0.03
IGL01432:Xpo6 APN 7 126124381 missense probably benign 0.31
IGL01627:Xpo6 APN 7 126149334 missense probably damaging 1.00
IGL01878:Xpo6 APN 7 126174193 missense probably benign 0.35
IGL02185:Xpo6 APN 7 126113808 splice site probably benign
IGL02744:Xpo6 APN 7 126108448 unclassified probably benign
IGL02927:Xpo6 APN 7 126156729 missense possibly damaging 0.86
IGL03216:Xpo6 APN 7 126104813 missense probably damaging 1.00
Cerise UTSW 7 126108844 missense probably damaging 1.00
Crayola UTSW 7 126107078 missense probably damaging 0.98
pastel UTSW 7 126108619 missense probably damaging 1.00
R0845:Xpo6 UTSW 7 126129543 splice site probably benign
R2349:Xpo6 UTSW 7 126113703 missense probably benign 0.18
R3051:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3052:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3053:Xpo6 UTSW 7 126104721 missense probably damaging 1.00
R3902:Xpo6 UTSW 7 126120409 missense probably damaging 1.00
R4011:Xpo6 UTSW 7 126140608 missense probably benign 0.13
R4231:Xpo6 UTSW 7 126174182 missense possibly damaging 0.66
R4569:Xpo6 UTSW 7 126128255 missense probably damaging 1.00
R4604:Xpo6 UTSW 7 126113752 missense possibly damaging 0.52
R4736:Xpo6 UTSW 7 126140583 missense probably benign
R4919:Xpo6 UTSW 7 126152943 missense probably benign 0.01
R4953:Xpo6 UTSW 7 126169271 missense probably damaging 1.00
R5017:Xpo6 UTSW 7 126104747 missense probably benign 0.31
R5590:Xpo6 UTSW 7 126107078 missense probably damaging 0.98
R5856:Xpo6 UTSW 7 126149502 intron probably benign
R6077:Xpo6 UTSW 7 126109952 missense possibly damaging 0.67
R6156:Xpo6 UTSW 7 126108844 missense probably damaging 1.00
R6256:Xpo6 UTSW 7 126108619 missense probably damaging 1.00
R6481:Xpo6 UTSW 7 126112885 missense probably damaging 1.00
R6500:Xpo6 UTSW 7 126171090 intron probably benign
R7407:Xpo6 UTSW 7 126171052 missense probably damaging 0.99
R7480:Xpo6 UTSW 7 126102333 nonsense probably null
X0012:Xpo6 UTSW 7 126169227 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGCTCTTGCTACAGTCAGTGCCTG -3'
(R):5'- GCTTGCCGTAAGCATTGCTTGTC -3'

Sequencing Primer
(F):5'- ggtcccccaaaagagcag -3'
(R):5'- AAGCATTGCTTGTCATGCCG -3'
Posted On2014-05-09