Incidental Mutation 'R1671:Olfr888'
ID187617
Institutional Source Beutler Lab
Gene Symbol Olfr888
Ensembl Gene ENSMUSG00000095527
Gene Nameolfactory receptor 888
SynonymsGA_x6K02T2PVTD-31787920-31788864, MOR162-4
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R1671 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38108128-38111381 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38109132 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 144 (M144V)
Ref Sequence ENSEMBL: ENSMUSP00000148476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075228] [ENSMUST00000211851]
Predicted Effect probably benign
Transcript: ENSMUST00000075228
AA Change: M149V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000074713
Gene: ENSMUSG00000095527
AA Change: M149V

DomainStartEndE-ValueType
Pfam:7tm_4 36 311 8.8e-49 PFAM
Pfam:7tm_1 46 293 3.9e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000211851
AA Change: M144V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Olfr888
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Olfr888 APN 9 38109562 missense probably damaging 1.00
IGL02158:Olfr888 APN 9 38109129 missense probably benign 0.09
IGL02713:Olfr888 APN 9 38109327 missense probably damaging 0.99
R0007:Olfr888 UTSW 9 38109094 missense possibly damaging 0.94
R0125:Olfr888 UTSW 9 38109519 missense probably benign 0.03
R0310:Olfr888 UTSW 9 38109486 missense possibly damaging 0.54
R3687:Olfr888 UTSW 9 38108881 missense probably damaging 1.00
R3704:Olfr888 UTSW 9 38109003 missense possibly damaging 0.95
R3708:Olfr888 UTSW 9 38109444 missense probably damaging 0.99
R3824:Olfr888 UTSW 9 38108838 missense possibly damaging 0.71
R3825:Olfr888 UTSW 9 38108838 missense possibly damaging 0.71
R4254:Olfr888 UTSW 9 38109250 missense probably damaging 1.00
R4828:Olfr888 UTSW 9 38108740 missense probably damaging 0.98
R7265:Olfr888 UTSW 9 38108931 missense possibly damaging 0.78
Z1088:Olfr888 UTSW 9 38109586 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGAAGAATGGCCTTCAGCAATGAC -3'
(R):5'- ATCACATGGGAGCCACACGTACTG -3'

Sequencing Primer
(F):5'- TAACCCCCAGAATGTTGGTG -3'
(R):5'- CTGGGTATTATTACATTGACACCCAC -3'
Posted On2014-05-09