Incidental Mutation 'R1671:Arhgef28'
ID187635
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene NameRho guanine nucleotide exchange factor (GEF) 28
SynonymsRhoGEF, Rgnef, Rho specific exchange factor, p190RhoGEF, 9230110L08Rik, D13Bwg1089e, RIP2
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1671 (G1)
Quality Score203
Status Validated
Chromosome13
Chromosomal Location97899469-98206439 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 97931034 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1461 (E1461G)
Ref Sequence ENSEMBL: ENSMUSP00000105053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000225884]
Predicted Effect possibly damaging
Transcript: ENSMUST00000109426
AA Change: E1461G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: E1461G

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect probably benign
Transcript: ENSMUST00000225884
Meta Mutation Damage Score 0.0548 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 97988277 missense probably benign 0.15
IGL00945:Arhgef28 APN 13 97967399 missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 97953972 splice site probably benign
IGL01328:Arhgef28 APN 13 97970323 missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 97953893 missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98077317 missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 97961314 missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98051028 missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 97931139 missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 97953783 missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98029883 missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98051058 missense probably benign 0.00
IGL02902:Arhgef28 APN 13 97946875 missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 97988286 missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98029373 splice site probably benign
IGL03106:Arhgef28 APN 13 97957793 missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 97951563 splice site probably null
IGL03325:Arhgef28 APN 13 97899816 missense probably benign 0.03
H8786:Arhgef28 UTSW 13 97946953 missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 97945696 missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 97956642 missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98075110 missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 97957716 missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 97970355 missense probably benign 0.21
R0711:Arhgef28 UTSW 13 97931254 missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 97939479 missense probably benign 0.16
R0790:Arhgef28 UTSW 13 97981406 missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 97929492 missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98075124 missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98075002 missense probably benign 0.01
R1490:Arhgef28 UTSW 13 97978444 missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 97965546 missense possibly damaging 0.93
R1660:Arhgef28 UTSW 13 97981376 missense probably benign 0.05
R1747:Arhgef28 UTSW 13 97936824 missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 97931186 missense probably benign 0.03
R1864:Arhgef28 UTSW 13 97994132 missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98145573 missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 97936816 splice site probably benign
R1987:Arhgef28 UTSW 13 97967096 missense probably benign
R2215:Arhgef28 UTSW 13 98051021 missense possibly damaging 0.78
R2342:Arhgef28 UTSW 13 97994029 missense probably benign 0.00
R2495:Arhgef28 UTSW 13 98029373 splice site probably benign
R3897:Arhgef28 UTSW 13 97956576 missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 97993944 missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 97994067 missense probably benign 0.16
R4086:Arhgef28 UTSW 13 97967204 missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98075000 missense probably benign 0.00
R4730:Arhgef28 UTSW 13 97978142 missense probably benign 0.00
R4735:Arhgef28 UTSW 13 97899729 missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 97929554 missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98075206 missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 97961460 missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 97929491 missense probably benign 0.01
R5594:Arhgef28 UTSW 13 97939492 missense probably benign 0.00
R5937:Arhgef28 UTSW 13 97939543 missense probably benign 0.00
R5987:Arhgef28 UTSW 13 97936860 nonsense probably null
R6015:Arhgef28 UTSW 13 98075022 missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 97985380 missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 97929409 critical splice donor site probably null
R6306:Arhgef28 UTSW 13 97985388 missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 97994019 missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 97988139 critical splice donor site probably null
R6646:Arhgef28 UTSW 13 97939494 missense probably benign 0.09
R6655:Arhgef28 UTSW 13 97899655 missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 97936716 missense probably damaging 0.96
R6707:Arhgef28 UTSW 13 98075116 missense possibly damaging 0.80
R6751:Arhgef28 UTSW 13 98075247 missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 97965530 missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 97965435 missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 97988261 missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 97944539 missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 97965452 missense probably benign
R7353:Arhgef28 UTSW 13 98075202 missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 97996862 missense probably benign 0.34
R7653:Arhgef28 UTSW 13 97969313 missense probably benign 0.04
Z1088:Arhgef28 UTSW 13 97945691 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATGTTTGGGTAAGCCCAGGGTAG -3'
(R):5'- CCAGGACAGTCACATTGAGATCCAC -3'

Sequencing Primer
(F):5'- TTGCTCCCTGGAGAGAAGAC -3'
(R):5'- ACTGGTTCTACAGCAGCG -3'
Posted On2014-05-09