Incidental Mutation 'R1671:Cyp4f14'
ID187646
Institutional Source Beutler Lab
Gene Symbol Cyp4f14
Ensembl Gene ENSMUSG00000024292
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 14
Synonymsleukotriene B4 omega hydroxylase, 1300014O15Rik
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1671 (G1)
Quality Score118
Status Validated
Chromosome17
Chromosomal Location32905071-32917342 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 32916909 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000136139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054174] [ENSMUST00000179434]
Predicted Effect probably benign
Transcript: ENSMUST00000054174
SMART Domains Protein: ENSMUSP00000050478
Gene: ENSMUSG00000024292

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179434
SMART Domains Protein: ENSMUSP00000136139
Gene: ENSMUSG00000024292

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced vitamin E-omega-hydroxylase activity and altered levels of tocopherols and their metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Pcsk5 C T 19: 17,454,868 C1461Y probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Cyp4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Cyp4f14 APN 17 32914566 missense probably benign 0.06
IGL00858:Cyp4f14 APN 17 32911718 splice site probably benign
IGL01673:Cyp4f14 APN 17 32911151 splice site probably null
IGL01716:Cyp4f14 APN 17 32905496 utr 3 prime probably benign
IGL01768:Cyp4f14 APN 17 32908002 missense probably damaging 1.00
IGL02314:Cyp4f14 APN 17 32906291 missense probably benign 0.12
IGL02697:Cyp4f14 APN 17 32905623 missense probably damaging 0.97
IGL03035:Cyp4f14 APN 17 32914634 missense probably benign 0.15
R1186:Cyp4f14 UTSW 17 32916786 missense probably benign
R1230:Cyp4f14 UTSW 17 32916788 missense probably benign 0.00
R1672:Cyp4f14 UTSW 17 32909236 missense probably benign 0.00
R1696:Cyp4f14 UTSW 17 32909171 missense possibly damaging 0.81
R1828:Cyp4f14 UTSW 17 32911235 missense probably damaging 0.98
R1934:Cyp4f14 UTSW 17 32906315 missense probably damaging 1.00
R2023:Cyp4f14 UTSW 17 32906531 missense probably damaging 1.00
R3013:Cyp4f14 UTSW 17 32909165 missense probably benign 0.01
R3783:Cyp4f14 UTSW 17 32916762 missense probably benign 0.00
R4013:Cyp4f14 UTSW 17 32916879 nonsense probably null
R4369:Cyp4f14 UTSW 17 32909258 missense probably benign
R4371:Cyp4f14 UTSW 17 32909258 missense probably benign
R4683:Cyp4f14 UTSW 17 32908011 missense probably null 0.78
R5282:Cyp4f14 UTSW 17 32907985 missense probably damaging 0.99
R5332:Cyp4f14 UTSW 17 32906091 missense probably benign 0.00
R5810:Cyp4f14 UTSW 17 32906098 missense possibly damaging 0.88
R6244:Cyp4f14 UTSW 17 32906317 missense probably benign 0.41
R6622:Cyp4f14 UTSW 17 32914645 missense probably benign
R6972:Cyp4f14 UTSW 17 32905509 missense probably benign 0.00
R6975:Cyp4f14 UTSW 17 32914634 missense probably benign 0.01
R7124:Cyp4f14 UTSW 17 32914588 missense not run
Predicted Primers PCR Primer
(F):5'- CCCTCGAAAGTCTGTCCACTTTGAC -3'
(R):5'- ATTGGCTGGCATAGAATGGCCC -3'

Sequencing Primer
(F):5'- CATAAGCCAGTTCCGTTTGGG -3'
(R):5'- ATTTTAGGGACCTAGCCTGGAAC -3'
Posted On2014-05-09