Incidental Mutation 'R1671:Pcsk5'
ID187653
Institutional Source Beutler Lab
Gene Symbol Pcsk5
Ensembl Gene ENSMUSG00000024713
Gene Nameproprotein convertase subtilisin/kexin type 5
SynonymsPC6, SPC6, b2b1549Clo, b2b585Clo, PC5A, PC5/6A
MMRRC Submission 039707-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1671 (G1)
Quality Score104
Status Validated
Chromosome19
Chromosomal Location17432832-17837632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 17454868 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 1461 (C1461Y)
Ref Sequence ENSEMBL: ENSMUSP00000025618 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025618]
Predicted Effect probably damaging
Transcript: ENSMUST00000025618
AA Change: C1461Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025618
Gene: ENSMUSG00000024713
AA Change: C1461Y

DomainStartEndE-ValueType
low complexity region 17 29 N/A INTRINSIC
Pfam:S8_pro-domain 40 116 4.6e-27 PFAM
Pfam:Peptidase_S8 164 447 2.1e-46 PFAM
Pfam:P_proprotein 507 597 2.1e-33 PFAM
FU 632 682 4.92e-13 SMART
FU 685 732 4.84e-12 SMART
EGF_like 690 723 3.29e1 SMART
FU 736 779 1.29e-7 SMART
FU 781 826 5.74e-14 SMART
FU 834 881 2.23e-11 SMART
EGF_like 839 870 3.43e1 SMART
FU 884 929 1.84e-12 SMART
FU 931 981 1.47e-11 SMART
FU 984 1030 1e-4 SMART
EGF_like 989 1020 2.92e1 SMART
FU 1034 1079 5.04e-10 SMART
FU 1081 1123 3.08e-5 SMART
FU 1127 1168 4.88e-8 SMART
FU 1206 1248 2.7e-10 SMART
EGF_like 1211 1239 5.91e1 SMART
FU 1252 1299 1.48e-7 SMART
EGF 1264 1305 1.69e1 SMART
FU 1301 1345 2.31e-9 SMART
FU 1347 1390 8.98e-7 SMART
EGF_like 1352 1381 7.23e1 SMART
FU 1392 1438 1.04e-11 SMART
FU 1442 1487 6.8e-7 SMART
EGF 1447 1476 2.16e1 SMART
FU 1491 1536 3.37e-11 SMART
FU 1540 1585 9.32e-14 SMART
EGF_like 1545 1576 2.8e1 SMART
FU 1589 1636 1.39e-12 SMART
FU 1640 1685 6.49e-13 SMART
EGF_like 1645 1676 6.67e1 SMART
FU 1691 1738 7.01e-9 SMART
transmembrane domain 1770 1789 N/A INTRINSIC
low complexity region 1827 1840 N/A INTRINSIC
low complexity region 1858 1876 N/A INTRINSIC
Meta Mutation Damage Score 0.376 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.3%
Validation Efficiency 100% (70/70)
MGI Phenotype FUNCTION: This gene encodes a subtilisin-like proprotein convertase that mediates posttranslational endoproteolytic processing of various proprotein substrates traversing the secretory pathway. The encoded protein is an inactive zymogen that undergoes autoproteolytic processing in the endoplasmic reticulum and the Golgi network to generate an active enzyme. Mice lacking the encoded protein die at an early embryonic stage. Conditional inactivation this gene in the epiblast but not in the extraembryonic tissue bypasses embryonic lethality but results in death at birth. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homozygous for a null mutation in this gene display embryonic lethality between E4.5-E7.5. Mice homozygous for ENU-induced mutations exhibit heterotaxia with congenital heart defects and immotile respiratory cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930578I06Rik A C 14: 63,973,188 L197R probably benign Het
Arglu1 A G 8: 8,683,896 V140A possibly damaging Het
Arhgef28 T C 13: 97,931,034 E1461G possibly damaging Het
Best3 A T 10: 117,024,668 D611V possibly damaging Het
C130026I21Rik C T 1: 85,257,385 probably null Het
Cenpf T C 1: 189,679,144 probably null Het
Cenpj A C 14: 56,565,045 M21R probably damaging Het
Cltc A T 11: 86,732,595 H201Q possibly damaging Het
Col28a1 A T 6: 8,083,773 N561K possibly damaging Het
Cyp2c70 G A 19: 40,153,637 P470L probably damaging Het
Cyp4f14 G A 17: 32,916,909 probably benign Het
Ddi1 A T 9: 6,266,225 V48D possibly damaging Het
Dnah11 A C 12: 117,916,788 Y3866D probably damaging Het
Dnah9 A G 11: 65,927,963 V3183A probably damaging Het
Elmo1 T A 13: 20,287,884 probably benign Het
Fap T A 2: 62,553,835 Y9F possibly damaging Het
Fbxo15 T A 18: 84,959,106 S93T possibly damaging Het
Gal3st2 C T 1: 93,873,678 R19C probably damaging Het
Gm6970 C A 19: 47,170,855 V94L possibly damaging Het
Gmnn A T 13: 24,752,071 *207R probably null Het
Gucy1a1 A C 3: 82,106,222 I371S probably damaging Het
Igsf10 G T 3: 59,328,500 S1420* probably null Het
Itih5 G T 2: 10,186,971 V106L probably benign Het
Itsn1 T A 16: 91,812,150 I201K probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lars2 C T 9: 123,418,279 T283I probably benign Het
Loxhd1 T C 18: 77,404,802 I1313T probably damaging Het
Mamdc4 T A 2: 25,568,223 R368* probably null Het
Mdga1 A T 17: 29,850,629 Y422N probably damaging Het
Mro A T 18: 73,870,055 probably benign Het
Mroh2b T C 15: 4,951,294 probably null Het
Nlrp1b C A 11: 71,201,259 V14L probably benign Het
Nos3 A G 5: 24,383,840 D1157G probably damaging Het
Nrxn2 C A 19: 6,473,750 R598S probably damaging Het
Olfr332 A T 11: 58,490,609 W49R possibly damaging Het
Olfr629 C A 7: 103,740,410 A277S possibly damaging Het
Olfr728 T C 14: 50,139,833 K269E probably damaging Het
Olfr888 A G 9: 38,109,132 M144V probably benign Het
Otog A T 7: 46,261,786 D687V probably damaging Het
Raet1d A G 10: 22,362,715 M1V probably null Het
Rnf6 A T 5: 146,211,188 L340* probably null Het
Rsl1d1 T C 16: 11,201,381 T99A probably damaging Het
Sbno1 A T 5: 124,392,067 probably null Het
Sipa1l1 A G 12: 82,397,461 Y982C probably damaging Het
Sorbs3 G T 14: 70,191,466 R417S possibly damaging Het
Sorl1 A G 9: 41,974,000 C2102R probably damaging Het
Sptbn1 T A 11: 30,142,245 I494F possibly damaging Het
Tank T A 2: 61,649,753 V211E probably damaging Het
Tbcd T A 11: 121,597,294 D840E probably benign Het
Tg T A 15: 66,692,387 C1146S possibly damaging Het
Tiam2 A T 17: 3,506,834 E110V probably damaging Het
Tle4 A T 19: 14,453,739 W560R probably damaging Het
Triml2 G A 8: 43,183,743 R76H possibly damaging Het
Ttn T C 2: 76,711,620 E25347G probably damaging Het
Ube2e2 A G 14: 18,586,889 L124P probably damaging Het
Vmn2r81 A G 10: 79,267,431 K153E probably benign Het
Wnt16 A T 6: 22,298,179 Y348F probably damaging Het
Xpo6 A G 7: 126,108,543 V897A possibly damaging Het
Zbtb26 T C 2: 37,436,365 T220A probably benign Het
Zik1 A T 7: 10,490,748 S141T probably damaging Het
Zkscan3 A G 13: 21,396,135 Y128H possibly damaging Het
Other mutations in Pcsk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pcsk5 APN 19 17511421 missense possibly damaging 0.49
IGL00423:Pcsk5 APN 19 17642559 missense probably benign 0.23
IGL01315:Pcsk5 APN 19 17451958 missense probably damaging 1.00
IGL01372:Pcsk5 APN 19 17617744 missense probably damaging 1.00
IGL01738:Pcsk5 APN 19 17433780 splice site probably benign
IGL01874:Pcsk5 APN 19 17595677 missense probably damaging 0.96
IGL02070:Pcsk5 APN 19 17439042 missense probably benign 0.25
IGL02311:Pcsk5 APN 19 17433420 nonsense probably null
IGL02436:Pcsk5 APN 19 17564708 critical splice donor site probably null
IGL02498:Pcsk5 APN 19 17511556 missense probably damaging 0.99
IGL02504:Pcsk5 APN 19 17477872 critical splice donor site probably null
IGL02664:Pcsk5 APN 19 17456770 missense probably damaging 1.00
IGL02735:Pcsk5 APN 19 17675468 missense probably damaging 1.00
IGL02941:Pcsk5 APN 19 17447501 missense probably damaging 1.00
PIT4377001:Pcsk5 UTSW 19 17439102 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0007:Pcsk5 UTSW 19 17654861 missense probably damaging 1.00
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0032:Pcsk5 UTSW 19 17564815 missense possibly damaging 0.81
R0373:Pcsk5 UTSW 19 17654849 missense probably damaging 1.00
R0784:Pcsk5 UTSW 19 17714769 missense probably benign 0.06
R0843:Pcsk5 UTSW 19 17654818 missense probably damaging 1.00
R1014:Pcsk5 UTSW 19 17564830 missense probably damaging 1.00
R1221:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R1435:Pcsk5 UTSW 19 17563882 nonsense probably null
R1471:Pcsk5 UTSW 19 17568324 missense probably damaging 1.00
R1564:Pcsk5 UTSW 19 17654756 missense probably damaging 1.00
R1597:Pcsk5 UTSW 19 17436600 missense probably benign 0.00
R1614:Pcsk5 UTSW 19 17515256 missense probably damaging 1.00
R1661:Pcsk5 UTSW 19 17447574 missense probably damaging 0.98
R1703:Pcsk5 UTSW 19 17752094 missense probably benign 0.15
R1793:Pcsk5 UTSW 19 17454750 missense possibly damaging 0.83
R1855:Pcsk5 UTSW 19 17515192 missense possibly damaging 0.93
R1909:Pcsk5 UTSW 19 17433461 missense probably benign 0.00
R1959:Pcsk5 UTSW 19 17433418 missense unknown
R2006:Pcsk5 UTSW 19 17477916 missense probably benign 0.32
R2045:Pcsk5 UTSW 19 17581144 missense possibly damaging 0.48
R2061:Pcsk5 UTSW 19 17454872 missense probably benign 0.03
R2110:Pcsk5 UTSW 19 17473059 missense probably damaging 1.00
R2402:Pcsk5 UTSW 19 17474834 nonsense probably null
R2496:Pcsk5 UTSW 19 17466158 nonsense probably null
R4115:Pcsk5 UTSW 19 17433419 missense unknown
R4504:Pcsk5 UTSW 19 17451955 missense probably damaging 1.00
R4616:Pcsk5 UTSW 19 17560750 missense probably benign 0.00
R4683:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R4717:Pcsk5 UTSW 19 17525267 missense probably damaging 1.00
R4761:Pcsk5 UTSW 19 17837148 missense possibly damaging 0.85
R4789:Pcsk5 UTSW 19 17433599 missense probably benign 0.09
R4880:Pcsk5 UTSW 19 17447690 missense probably damaging 1.00
R5100:Pcsk5 UTSW 19 17515135 critical splice donor site probably null
R5114:Pcsk5 UTSW 19 17675585 missense probably damaging 1.00
R5116:Pcsk5 UTSW 19 17463434 missense possibly damaging 0.87
R5193:Pcsk5 UTSW 19 17564810 missense possibly damaging 0.79
R5279:Pcsk5 UTSW 19 17595658 splice site probably null
R5334:Pcsk5 UTSW 19 17461851 missense probably benign 0.00
R5369:Pcsk5 UTSW 19 17581255 missense probably damaging 1.00
R5451:Pcsk5 UTSW 19 17463356 missense possibly damaging 0.91
R5547:Pcsk5 UTSW 19 17752124 missense probably benign 0.08
R5630:Pcsk5 UTSW 19 17575831 missense probably benign 0.04
R5805:Pcsk5 UTSW 19 17456829 missense probably benign 0.01
R6063:Pcsk5 UTSW 19 17454681 critical splice donor site probably null
R6130:Pcsk5 UTSW 19 17511556 missense probably damaging 0.99
R6153:Pcsk5 UTSW 19 17511492 missense probably damaging 0.98
R6163:Pcsk5 UTSW 19 17473041 missense probably damaging 1.00
R6164:Pcsk5 UTSW 19 17836953 critical splice donor site probably null
R6228:Pcsk5 UTSW 19 17581267 missense possibly damaging 0.91
R6426:Pcsk5 UTSW 19 17617729 missense probably damaging 1.00
R6601:Pcsk5 UTSW 19 17511380 missense probably benign 0.00
R6648:Pcsk5 UTSW 19 17575821 missense probably damaging 0.99
R6789:Pcsk5 UTSW 19 17456786 missense possibly damaging 0.93
R6807:Pcsk5 UTSW 19 17572622 splice site probably null
R6837:Pcsk5 UTSW 19 17439084 missense probably benign 0.01
R6998:Pcsk5 UTSW 19 17473112 missense probably benign 0.20
R7051:Pcsk5 UTSW 19 17433731 missense probably benign 0.00
R7164:Pcsk5 UTSW 19 17451985 missense probably damaging 1.00
R7173:Pcsk5 UTSW 19 17477877 missense possibly damaging 0.85
R7348:Pcsk5 UTSW 19 17456818 nonsense probably null
R7360:Pcsk5 UTSW 19 17515213 missense probably benign 0.00
X0023:Pcsk5 UTSW 19 17474872 missense possibly damaging 0.66
X0063:Pcsk5 UTSW 19 17447604 missense probably damaging 1.00
Z1088:Pcsk5 UTSW 19 17463374 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGTATAGCACTGGTCCTCAGAAGG -3'
(R):5'- TCTCACACTGGCACTGTGCATTG -3'

Sequencing Primer
(F):5'- TCAGAAGGCCCTGAGCAG -3'
(R):5'- CAAAGATGCCCTTTACCATTGG -3'
Posted On2014-05-09