Incidental Mutation 'R1672:Dnah1'
ID187742
Institutional Source Beutler Lab
Gene Symbol Dnah1
Ensembl Gene ENSMUSG00000019027
Gene Namedynein, axonemal, heavy chain 1
SynonymsE030034C22Rik, MDHC7, Dnahc1, B230373P09Rik
MMRRC Submission 039708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1672 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location31260375-31323896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 31276200 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 2560 (L2560P)
Ref Sequence ENSEMBL: ENSMUSP00000043281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048603]
Predicted Effect probably damaging
Transcript: ENSMUST00000048603
AA Change: L2560P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043281
Gene: ENSMUSG00000019027
AA Change: L2560P

DomainStartEndE-ValueType
low complexity region 43 59 N/A INTRINSIC
Pfam:DHC_N2 998 1404 6.3e-146 PFAM
AAA 1558 1697 6.02e-1 SMART
AAA 1839 2077 4.66e0 SMART
low complexity region 2149 2157 N/A INTRINSIC
AAA 2204 2353 2.35e-1 SMART
Pfam:AAA_8 2533 2803 7.7e-84 PFAM
Pfam:MT 2815 3165 9.9e-57 PFAM
Pfam:AAA_9 3185 3410 1.1e-93 PFAM
Pfam:Dynein_heavy 3545 4246 2.7e-275 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228755
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228927
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an inner dynein arm heavy chain that provides structural support between the radial spokes and the outer doublet of the sperm tail. Naturally occurring mutations in this gene are associated with primary ciliary dyskinesia and multiple morphological anomalies of the flagella that result in asthenozoospermia and male infertility. Mice with a homozygous knockout of the orthologous gene are viable but have reduced sperm motility and are infertile. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutants are male sterile, and show impaired ciliary and flagellar motility that is also observed in the tracheal cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik G A 16: 88,627,208 Q132* probably null Het
4930430A15Rik T A 2: 111,220,774 M226L probably benign Het
Aadacl4 T A 4: 144,623,319 L382* probably null Het
Afg3l2 A G 18: 67,407,423 I672T probably benign Het
Aftph A T 11: 20,726,762 D282E probably benign Het
Agpat5 A G 8: 18,870,914 N161S probably benign Het
Alpk2 C T 18: 65,280,959 E1562K probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apobr A G 7: 126,587,551 R745G probably benign Het
Arrdc5 T C 17: 56,300,144 T34A possibly damaging Het
Astl T C 2: 127,347,243 L163P probably damaging Het
Atf7ip2 A T 16: 10,209,141 H91L probably damaging Het
Atp13a3 A T 16: 30,332,274 S1073T possibly damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Brinp1 T C 4: 68,829,283 probably null Het
Capn9 A G 8: 124,613,831 N578S probably benign Het
Casp2 T A 6: 42,268,908 D166E probably damaging Het
Ccr1l1 A T 9: 123,977,507 I301N probably damaging Het
Chtop T A 3: 90,507,567 T15S probably damaging Het
Coq5 T A 5: 115,279,916 probably null Het
Crbn G A 6: 106,795,925 P34L probably damaging Het
Crisp1 G T 17: 40,308,869 D59E possibly damaging Het
Cyp4f14 A T 17: 32,909,236 D268E probably benign Het
D5Ertd579e T C 5: 36,613,277 D1258G possibly damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb25 T C 2: 152,622,490 M45V probably benign Het
Dffa T C 4: 149,106,245 L77P probably damaging Het
Dixdc1 T C 9: 50,689,864 Q361R probably damaging Het
Fabp5 A G 3: 10,015,541 T108A probably benign Het
Fam149a T G 8: 45,339,374 probably null Het
Fam20c A G 5: 138,807,301 Y430C probably damaging Het
Fat1 A G 8: 45,036,835 T3595A probably damaging Het
Fbp1 A G 13: 62,867,431 Y245H probably damaging Het
Frem1 C T 4: 82,998,891 R605H probably benign Het
Fscb A G 12: 64,471,518 I1058T unknown Het
Fyb2 A G 4: 104,950,862 K373R probably benign Het
Ggta1 A T 2: 35,402,133 Y387* probably null Het
Gm18856 T C 13: 13,965,757 probably benign Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gpd2 A T 2: 57,357,700 I552F probably damaging Het
Grk5 T C 19: 61,086,215 probably null Het
Hivep1 T C 13: 42,160,284 V2000A probably damaging Het
Ipo5 C T 14: 120,933,302 L466F probably damaging Het
Itgb1 G A 8: 128,732,045 S785N probably damaging Het
Itpr3 G A 17: 27,089,013 R258K probably benign Het
Kcnk12 A G 17: 87,746,319 V305A probably benign Het
Klf5 C T 14: 99,301,550 T133I probably damaging Het
Lrig2 A G 3: 104,491,812 I178T probably damaging Het
Lyrm4 A T 13: 36,092,924 M30K probably benign Het
Mpv17 A G 5: 31,153,719 Y7H probably damaging Het
Mrps22 T C 9: 98,596,816 probably null Het
Myof A T 19: 37,943,479 W967R probably damaging Het
Naip1 C T 13: 100,423,149 D1116N probably benign Het
Olfr150 G A 9: 39,737,196 C127Y probably damaging Het
Olfr393 T C 11: 73,847,955 T57A probably benign Het
Olfr792 C A 10: 129,540,692 H52N probably benign Het
Olfr826 T C 10: 130,180,392 T163A probably benign Het
Ovol2 T C 2: 144,305,790 Y180C probably damaging Het
Pacs1 T C 19: 5,152,309 S418G probably benign Het
Pcdh1 T C 18: 38,192,180 E903G probably damaging Het
Pcdhb15 A T 18: 37,474,660 Y315F probably damaging Het
Pex1 T C 5: 3,626,085 L891P probably damaging Het
Ppfia2 G A 10: 106,830,568 M378I possibly damaging Het
Ppp1r9a T A 6: 5,143,491 probably null Het
Prm3 T C 16: 10,790,699 E64G possibly damaging Het
Prmt6 T C 3: 110,250,571 D134G possibly damaging Het
Prss42 G A 9: 110,800,928 G250D probably damaging Het
Pwwp2b G A 7: 139,254,831 V63I probably benign Het
Rbm17 T C 2: 11,585,719 D375G possibly damaging Het
Rhbdl1 A T 17: 25,836,409 probably null Het
Rims2 T A 15: 39,292,189 D128E probably benign Het
Rock2 A G 12: 16,965,652 K850R probably benign Het
Rreb1 T C 13: 37,930,537 I624T probably benign Het
Rrp36 A T 17: 46,672,414 D91E probably damaging Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sec24a A T 11: 51,743,948 Y50* probably null Het
Sh2d4b A G 14: 40,892,964 M1T probably null Het
Slc4a7 A G 14: 14,760,247 I561V possibly damaging Het
Slc7a12 T C 3: 14,499,277 V70A possibly damaging Het
Slfnl1 A T 4: 120,535,775 I355F probably damaging Het
Spata2 C T 2: 167,483,519 R460H probably damaging Het
Stk11ip C T 1: 75,528,985 Q433* probably null Het
Susd1 T C 4: 59,411,395 Y146C probably damaging Het
Susd5 A T 9: 114,068,822 D115V probably damaging Het
Tas2r110 T A 6: 132,868,066 V20E probably damaging Het
Tbc1d4 T C 14: 101,475,215 Y694C possibly damaging Het
Tmem131 T C 1: 36,824,759 E640G probably damaging Het
Togaram1 A G 12: 65,021,568 T1782A probably benign Het
Trim24 T C 6: 37,915,279 L249P probably damaging Het
Ttf1 T C 2: 29,067,152 I478T probably damaging Het
Upf2 T A 2: 6,040,097 probably null Het
Urb1 A T 16: 90,787,397 C566S probably damaging Het
Vmn1r191 T C 13: 22,179,092 N164S probably benign Het
Vmn2r81 T A 10: 79,268,278 V245E probably damaging Het
Vwce T A 19: 10,653,095 F506Y possibly damaging Het
Wnt8b T C 19: 44,511,276 F155L probably damaging Het
Xrra1 A T 7: 99,898,440 I279F probably benign Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Zfp607b C T 7: 27,692,523 H8Y possibly damaging Het
Zfp933 A T 4: 147,826,019 H373Q probably damaging Het
Zfp938 A G 10: 82,225,148 L546P probably benign Het
Zfp988 C T 4: 147,331,282 R58C probably benign Het
Zkscan14 C T 5: 145,201,654 V8I probably benign Het
Other mutations in Dnah1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Dnah1 APN 14 31287873 missense probably benign 0.01
IGL00227:Dnah1 APN 14 31286896 missense probably damaging 1.00
IGL00491:Dnah1 APN 14 31261839 missense probably damaging 1.00
IGL00787:Dnah1 APN 14 31300063 missense possibly damaging 0.91
IGL00809:Dnah1 APN 14 31300809 nonsense probably null
IGL00911:Dnah1 APN 14 31304434 splice site probably null
IGL00949:Dnah1 APN 14 31307090 missense probably benign 0.00
IGL00976:Dnah1 APN 14 31278138 missense probably damaging 1.00
IGL01484:Dnah1 APN 14 31299940 missense probably damaging 0.98
IGL01629:Dnah1 APN 14 31292320 missense probably damaging 1.00
IGL01716:Dnah1 APN 14 31263378 missense probably benign 0.34
IGL01893:Dnah1 APN 14 31266470 missense probably damaging 1.00
IGL01933:Dnah1 APN 14 31310915 missense probably benign 0.40
IGL01938:Dnah1 APN 14 31283887 missense probably benign
IGL02032:Dnah1 APN 14 31274369 missense probably benign
IGL02052:Dnah1 APN 14 31268786 missense probably damaging 0.99
IGL02097:Dnah1 APN 14 31305001 missense possibly damaging 0.92
IGL02127:Dnah1 APN 14 31304928 missense probably benign 0.00
IGL02143:Dnah1 APN 14 31283289 missense probably damaging 1.00
IGL02158:Dnah1 APN 14 31300967 missense probably benign 0.00
IGL02442:Dnah1 APN 14 31287878 missense probably damaging 1.00
IGL02525:Dnah1 APN 14 31305833 missense probably benign 0.05
IGL02558:Dnah1 APN 14 31274379 missense possibly damaging 0.96
IGL02633:Dnah1 APN 14 31284815 missense probably benign 0.05
IGL02720:Dnah1 APN 14 31262220 missense probably damaging 0.96
IGL02728:Dnah1 APN 14 31283998 missense probably benign 0.44
IGL02738:Dnah1 APN 14 31292640 missense probably benign 0.27
IGL02863:Dnah1 APN 14 31295293 missense probably damaging 0.99
IGL02944:Dnah1 APN 14 31300871 missense possibly damaging 0.88
IGL03110:Dnah1 APN 14 31266717 missense probably benign 0.40
IGL03201:Dnah1 APN 14 31300949 missense probably benign 0.13
IGL03215:Dnah1 APN 14 31274391 missense probably damaging 1.00
IGL03230:Dnah1 APN 14 31270066 missense probably damaging 1.00
IGL03248:Dnah1 APN 14 31269889 missense probably damaging 1.00
IGL03267:Dnah1 APN 14 31286588 missense probably benign 0.00
IGL03299:Dnah1 APN 14 31315122 nonsense probably null
IGL03301:Dnah1 APN 14 31292692 missense probably damaging 1.00
ergonomic UTSW 14 31300748 missense possibly damaging 0.91
faraday UTSW 14 31310882 missense probably null 0.05
K3955:Dnah1 UTSW 14 31266459 missense probably benign
PIT1430001:Dnah1 UTSW 14 31262580 missense probably damaging 1.00
PIT4382001:Dnah1 UTSW 14 31284455 missense probably damaging 1.00
R0043:Dnah1 UTSW 14 31274405 missense probably damaging 0.97
R0092:Dnah1 UTSW 14 31271609 missense probably benign 0.00
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0100:Dnah1 UTSW 14 31262152 critical splice donor site probably null
R0101:Dnah1 UTSW 14 31283899 missense probably damaging 1.00
R0119:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0136:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0144:Dnah1 UTSW 14 31267874 splice site probably benign
R0279:Dnah1 UTSW 14 31302375 missense possibly damaging 0.94
R0299:Dnah1 UTSW 14 31276158 missense probably damaging 1.00
R0316:Dnah1 UTSW 14 31278151 missense probably benign 0.00
R0739:Dnah1 UTSW 14 31265915 nonsense probably null
R0789:Dnah1 UTSW 14 31304591 missense probably benign
R0826:Dnah1 UTSW 14 31303907 missense probably benign 0.02
R1102:Dnah1 UTSW 14 31296457 nonsense probably null
R1116:Dnah1 UTSW 14 31307867 missense probably benign 0.13
R1229:Dnah1 UTSW 14 31310851 missense probably benign 0.11
R1447:Dnah1 UTSW 14 31306898 missense probably benign 0.06
R1449:Dnah1 UTSW 14 31263951 missense probably damaging 1.00
R1462:Dnah1 UTSW 14 31268781 splice site probably benign
R1482:Dnah1 UTSW 14 31294874 missense probably damaging 1.00
R1500:Dnah1 UTSW 14 31316758 missense probably benign
R1512:Dnah1 UTSW 14 31293037 missense probably damaging 1.00
R1591:Dnah1 UTSW 14 31272332 missense probably benign 0.01
R1598:Dnah1 UTSW 14 31301262 missense probably benign 0.07
R1644:Dnah1 UTSW 14 31302292 splice site probably benign
R1713:Dnah1 UTSW 14 31279182 missense probably damaging 1.00
R1769:Dnah1 UTSW 14 31310882 missense probably null 0.05
R1796:Dnah1 UTSW 14 31261093 missense probably benign 0.00
R1902:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1903:Dnah1 UTSW 14 31319759 missense probably damaging 0.99
R1905:Dnah1 UTSW 14 31264630 missense probably benign 0.06
R1908:Dnah1 UTSW 14 31262558 missense probably damaging 1.00
R1972:Dnah1 UTSW 14 31265391 nonsense probably null
R1973:Dnah1 UTSW 14 31265391 nonsense probably null
R2004:Dnah1 UTSW 14 31301856 missense possibly damaging 0.79
R2051:Dnah1 UTSW 14 31279123 missense probably damaging 1.00
R2062:Dnah1 UTSW 14 31271129 missense probably damaging 1.00
R2188:Dnah1 UTSW 14 31279164 missense probably damaging 0.98
R2240:Dnah1 UTSW 14 31299974 missense probably benign 0.00
R2862:Dnah1 UTSW 14 31284762 missense probably benign 0.21
R2894:Dnah1 UTSW 14 31298761 missense possibly damaging 0.67
R3120:Dnah1 UTSW 14 31266822 nonsense probably null
R3410:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3411:Dnah1 UTSW 14 31269817 missense possibly damaging 0.55
R3435:Dnah1 UTSW 14 31316674 missense probably damaging 0.96
R3615:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3616:Dnah1 UTSW 14 31315148 missense possibly damaging 0.92
R3741:Dnah1 UTSW 14 31265467 splice site probably benign
R3805:Dnah1 UTSW 14 31294763 missense possibly damaging 0.67
R3894:Dnah1 UTSW 14 31307028 missense probably benign
R4007:Dnah1 UTSW 14 31303784 splice site probably benign
R4201:Dnah1 UTSW 14 31262270 missense probably benign 0.00
R4232:Dnah1 UTSW 14 31304916 missense probably benign
R4372:Dnah1 UTSW 14 31304922 missense probably damaging 1.00
R4391:Dnah1 UTSW 14 31294835 missense probably damaging 1.00
R4423:Dnah1 UTSW 14 31284761 missense probably benign 0.00
R4526:Dnah1 UTSW 14 31285998 missense probably benign 0.05
R4650:Dnah1 UTSW 14 31284887 splice site probably null
R4723:Dnah1 UTSW 14 31272942 missense probably damaging 1.00
R4748:Dnah1 UTSW 14 31319945 missense probably benign
R4783:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4784:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4785:Dnah1 UTSW 14 31263479 missense probably damaging 1.00
R4843:Dnah1 UTSW 14 31264963 missense probably damaging 1.00
R4879:Dnah1 UTSW 14 31300748 missense possibly damaging 0.91
R4897:Dnah1 UTSW 14 31267539 missense probably damaging 1.00
R4911:Dnah1 UTSW 14 31295323 missense probably damaging 1.00
R4985:Dnah1 UTSW 14 31286898 missense probably null 1.00
R5070:Dnah1 UTSW 14 31282418 missense probably benign 0.05
R5128:Dnah1 UTSW 14 31296195 splice site probably null
R5409:Dnah1 UTSW 14 31263255 missense probably damaging 1.00
R5436:Dnah1 UTSW 14 31316747 missense probably benign
R5481:Dnah1 UTSW 14 31308871 missense possibly damaging 0.55
R5550:Dnah1 UTSW 14 31316708 missense probably benign 0.00
R5555:Dnah1 UTSW 14 31290819 missense probably damaging 0.99
R5566:Dnah1 UTSW 14 31274366 missense probably benign 0.35
R5623:Dnah1 UTSW 14 31286023 missense possibly damaging 0.62
R5701:Dnah1 UTSW 14 31274044 missense probably damaging 1.00
R5751:Dnah1 UTSW 14 31310906 missense probably benign 0.00
R5823:Dnah1 UTSW 14 31266418 missense possibly damaging 0.92
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6030:Dnah1 UTSW 14 31268027 missense probably damaging 1.00
R6090:Dnah1 UTSW 14 31269425 missense possibly damaging 0.83
R6139:Dnah1 UTSW 14 31286027 missense probably benign 0.02
R6145:Dnah1 UTSW 14 31300970 missense probably benign 0.07
R6306:Dnah1 UTSW 14 31304587 missense probably damaging 0.97
R6376:Dnah1 UTSW 14 31275608 missense probably damaging 1.00
R6451:Dnah1 UTSW 14 31300808 missense probably benign 0.08
R6549:Dnah1 UTSW 14 31269383 missense probably damaging 1.00
R6748:Dnah1 UTSW 14 31299988 missense probably damaging 0.99
R6826:Dnah1 UTSW 14 31286290 missense probably benign 0.00
R6870:Dnah1 UTSW 14 31271061 nonsense probably null
R6932:Dnah1 UTSW 14 31287776 missense probably damaging 1.00
R6944:Dnah1 UTSW 14 31268904 missense probably damaging 1.00
R7033:Dnah1 UTSW 14 31264925 missense probably damaging 1.00
R7078:Dnah1 UTSW 14 31297110 missense probably damaging 1.00
R7133:Dnah1 UTSW 14 31286076 missense probably benign
R7136:Dnah1 UTSW 14 31298656 missense probably damaging 1.00
R7203:Dnah1 UTSW 14 31274382 missense probably benign
R7241:Dnah1 UTSW 14 31264939 missense probably benign 0.00
R7260:Dnah1 UTSW 14 31269386 missense probably damaging 1.00
R7264:Dnah1 UTSW 14 31269894 missense probably benign
R7291:Dnah1 UTSW 14 31298705 missense probably damaging 1.00
R7293:Dnah1 UTSW 14 31287863 missense probably damaging 1.00
R7300:Dnah1 UTSW 14 31269841 missense probably benign 0.05
R7319:Dnah1 UTSW 14 31296594 missense probably benign 0.02
R7323:Dnah1 UTSW 14 31298707 missense probably damaging 1.00
Z1088:Dnah1 UTSW 14 31304811 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GGTTTATGTTGGGGCAACACCAGG -3'
(R):5'- GCCAGGTCACAGAGTAGTCAATCAC -3'

Sequencing Primer
(F):5'- ACCACGATCCCTTACATGTG -3'
(R):5'- ACTGACATTTCTGGGTCTGAACAG -3'
Posted On2014-05-09