Incidental Mutation 'R1672:Cyp4f14'
ID187758
Institutional Source Beutler Lab
Gene Symbol Cyp4f14
Ensembl Gene ENSMUSG00000024292
Gene Namecytochrome P450, family 4, subfamily f, polypeptide 14
Synonymsleukotriene B4 omega hydroxylase, 1300014O15Rik
MMRRC Submission 039708-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1672 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32905071-32917342 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 32909236 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 268 (D268E)
Ref Sequence ENSEMBL: ENSMUSP00000136139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054174] [ENSMUST00000179434]
Predicted Effect probably benign
Transcript: ENSMUST00000054174
AA Change: D268E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050478
Gene: ENSMUSG00000024292
AA Change: D268E

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179434
AA Change: D268E

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000136139
Gene: ENSMUSG00000024292
AA Change: D268E

DomainStartEndE-ValueType
Pfam:p450 52 515 2.7e-136 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This protein likely localizes to the endoplasmic reticulum. When expressed in yeast the enzyme is capable of oxdizing arachidonic acid. It can also catalyze the epoxidation of 22:6n-3 and 22:5n-3 polyunsaturated long-chain fatty acids. This gene is part of a cluster of cytochrome P450 genes on chromosome 19. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced vitamin E-omega-hydroxylase activity and altered levels of tocopherols and their metabolites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 103 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310079G19Rik G A 16: 88,627,208 Q132* probably null Het
4930430A15Rik T A 2: 111,220,774 M226L probably benign Het
Aadacl4 T A 4: 144,623,319 L382* probably null Het
Afg3l2 A G 18: 67,407,423 I672T probably benign Het
Aftph A T 11: 20,726,762 D282E probably benign Het
Agpat5 A G 8: 18,870,914 N161S probably benign Het
Alpk2 C T 18: 65,280,959 E1562K probably damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Apobr A G 7: 126,587,551 R745G probably benign Het
Arrdc5 T C 17: 56,300,144 T34A possibly damaging Het
Astl T C 2: 127,347,243 L163P probably damaging Het
Atf7ip2 A T 16: 10,209,141 H91L probably damaging Het
Atp13a3 A T 16: 30,332,274 S1073T possibly damaging Het
Bcl2a1a A T 9: 88,957,450 I134L probably damaging Het
Brinp1 T C 4: 68,829,283 probably null Het
Capn9 A G 8: 124,613,831 N578S probably benign Het
Casp2 T A 6: 42,268,908 D166E probably damaging Het
Ccr1l1 A T 9: 123,977,507 I301N probably damaging Het
Chtop T A 3: 90,507,567 T15S probably damaging Het
Coq5 T A 5: 115,279,916 probably null Het
Crbn G A 6: 106,795,925 P34L probably damaging Het
Crisp1 G T 17: 40,308,869 D59E possibly damaging Het
D5Ertd579e T C 5: 36,613,277 D1258G possibly damaging Het
Dcp1b T C 6: 119,217,911 S531P probably benign Het
Defb25 T C 2: 152,622,490 M45V probably benign Het
Dffa T C 4: 149,106,245 L77P probably damaging Het
Dixdc1 T C 9: 50,689,864 Q361R probably damaging Het
Dnah1 A G 14: 31,276,200 L2560P probably damaging Het
Fabp5 A G 3: 10,015,541 T108A probably benign Het
Fam149a T G 8: 45,339,374 probably null Het
Fam20c A G 5: 138,807,301 Y430C probably damaging Het
Fat1 A G 8: 45,036,835 T3595A probably damaging Het
Fbp1 A G 13: 62,867,431 Y245H probably damaging Het
Frem1 C T 4: 82,998,891 R605H probably benign Het
Fscb A G 12: 64,471,518 I1058T unknown Het
Fyb2 A G 4: 104,950,862 K373R probably benign Het
Ggta1 A T 2: 35,402,133 Y387* probably null Het
Gm18856 T C 13: 13,965,757 probably benign Het
Gm572 T C 4: 148,668,509 S282P possibly damaging Het
Gpd2 A T 2: 57,357,700 I552F probably damaging Het
Grk5 T C 19: 61,086,215 probably null Het
Hivep1 T C 13: 42,160,284 V2000A probably damaging Het
Ipo5 C T 14: 120,933,302 L466F probably damaging Het
Itgb1 G A 8: 128,732,045 S785N probably damaging Het
Itpr3 G A 17: 27,089,013 R258K probably benign Het
Kcnk12 A G 17: 87,746,319 V305A probably benign Het
Klf5 C T 14: 99,301,550 T133I probably damaging Het
Lrig2 A G 3: 104,491,812 I178T probably damaging Het
Lyrm4 A T 13: 36,092,924 M30K probably benign Het
Mpv17 A G 5: 31,153,719 Y7H probably damaging Het
Mrps22 T C 9: 98,596,816 probably null Het
Myof A T 19: 37,943,479 W967R probably damaging Het
Naip1 C T 13: 100,423,149 D1116N probably benign Het
Olfr150 G A 9: 39,737,196 C127Y probably damaging Het
Olfr393 T C 11: 73,847,955 T57A probably benign Het
Olfr792 C A 10: 129,540,692 H52N probably benign Het
Olfr826 T C 10: 130,180,392 T163A probably benign Het
Ovol2 T C 2: 144,305,790 Y180C probably damaging Het
Pacs1 T C 19: 5,152,309 S418G probably benign Het
Pcdh1 T C 18: 38,192,180 E903G probably damaging Het
Pcdhb15 A T 18: 37,474,660 Y315F probably damaging Het
Pex1 T C 5: 3,626,085 L891P probably damaging Het
Ppfia2 G A 10: 106,830,568 M378I possibly damaging Het
Ppp1r9a T A 6: 5,143,491 probably null Het
Prm3 T C 16: 10,790,699 E64G possibly damaging Het
Prmt6 T C 3: 110,250,571 D134G possibly damaging Het
Prss42 G A 9: 110,800,928 G250D probably damaging Het
Pwwp2b G A 7: 139,254,831 V63I probably benign Het
Rbm17 T C 2: 11,585,719 D375G possibly damaging Het
Rhbdl1 A T 17: 25,836,409 probably null Het
Rims2 T A 15: 39,292,189 D128E probably benign Het
Rock2 A G 12: 16,965,652 K850R probably benign Het
Rreb1 T C 13: 37,930,537 I624T probably benign Het
Rrp36 A T 17: 46,672,414 D91E probably damaging Het
Scn7a C T 2: 66,697,600 D849N possibly damaging Het
Sec24a A T 11: 51,743,948 Y50* probably null Het
Sh2d4b A G 14: 40,892,964 M1T probably null Het
Slc4a7 A G 14: 14,760,247 I561V possibly damaging Het
Slc7a12 T C 3: 14,499,277 V70A possibly damaging Het
Slfnl1 A T 4: 120,535,775 I355F probably damaging Het
Spata2 C T 2: 167,483,519 R460H probably damaging Het
Stk11ip C T 1: 75,528,985 Q433* probably null Het
Susd1 T C 4: 59,411,395 Y146C probably damaging Het
Susd5 A T 9: 114,068,822 D115V probably damaging Het
Tas2r110 T A 6: 132,868,066 V20E probably damaging Het
Tbc1d4 T C 14: 101,475,215 Y694C possibly damaging Het
Tmem131 T C 1: 36,824,759 E640G probably damaging Het
Togaram1 A G 12: 65,021,568 T1782A probably benign Het
Trim24 T C 6: 37,915,279 L249P probably damaging Het
Ttf1 T C 2: 29,067,152 I478T probably damaging Het
Upf2 T A 2: 6,040,097 probably null Het
Urb1 A T 16: 90,787,397 C566S probably damaging Het
Vmn1r191 T C 13: 22,179,092 N164S probably benign Het
Vmn2r81 T A 10: 79,268,278 V245E probably damaging Het
Vwce T A 19: 10,653,095 F506Y possibly damaging Het
Wnt8b T C 19: 44,511,276 F155L probably damaging Het
Xrra1 A T 7: 99,898,440 I279F probably benign Het
Zfp229 T C 17: 21,745,847 S353P probably damaging Het
Zfp607b C T 7: 27,692,523 H8Y possibly damaging Het
Zfp933 A T 4: 147,826,019 H373Q probably damaging Het
Zfp938 A G 10: 82,225,148 L546P probably benign Het
Zfp988 C T 4: 147,331,282 R58C probably benign Het
Zkscan14 C T 5: 145,201,654 V8I probably benign Het
Other mutations in Cyp4f14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Cyp4f14 APN 17 32914566 missense probably benign 0.06
IGL00858:Cyp4f14 APN 17 32911718 splice site probably benign
IGL01673:Cyp4f14 APN 17 32911151 splice site probably null
IGL01716:Cyp4f14 APN 17 32905496 utr 3 prime probably benign
IGL01768:Cyp4f14 APN 17 32908002 missense probably damaging 1.00
IGL02314:Cyp4f14 APN 17 32906291 missense probably benign 0.12
IGL02697:Cyp4f14 APN 17 32905623 missense probably damaging 0.97
IGL03035:Cyp4f14 APN 17 32914634 missense probably benign 0.15
R1186:Cyp4f14 UTSW 17 32916786 missense probably benign
R1230:Cyp4f14 UTSW 17 32916788 missense probably benign 0.00
R1671:Cyp4f14 UTSW 17 32916909 intron probably benign
R1696:Cyp4f14 UTSW 17 32909171 missense possibly damaging 0.81
R1828:Cyp4f14 UTSW 17 32911235 missense probably damaging 0.98
R1934:Cyp4f14 UTSW 17 32906315 missense probably damaging 1.00
R2023:Cyp4f14 UTSW 17 32906531 missense probably damaging 1.00
R3013:Cyp4f14 UTSW 17 32909165 missense probably benign 0.01
R3783:Cyp4f14 UTSW 17 32916762 missense probably benign 0.00
R4013:Cyp4f14 UTSW 17 32916879 nonsense probably null
R4369:Cyp4f14 UTSW 17 32909258 missense probably benign
R4371:Cyp4f14 UTSW 17 32909258 missense probably benign
R4683:Cyp4f14 UTSW 17 32908011 missense probably null 0.78
R5282:Cyp4f14 UTSW 17 32907985 missense probably damaging 0.99
R5332:Cyp4f14 UTSW 17 32906091 missense probably benign 0.00
R5810:Cyp4f14 UTSW 17 32906098 missense possibly damaging 0.88
R6244:Cyp4f14 UTSW 17 32906317 missense probably benign 0.41
R6622:Cyp4f14 UTSW 17 32914645 missense probably benign
R6972:Cyp4f14 UTSW 17 32905509 missense probably benign 0.00
R6975:Cyp4f14 UTSW 17 32914634 missense probably benign 0.01
R7124:Cyp4f14 UTSW 17 32914588 missense not run
Predicted Primers PCR Primer
(F):5'- CTGTGTGACCCACAGGATGAGAATG -3'
(R):5'- TGTGGAGGCAGCTCACAGAGATATG -3'

Sequencing Primer
(F):5'- TATTTCATCCCCCTGGAAAAGG -3'
(R):5'- GTTAAATTGCTGTCTCCTAAATCCTG -3'
Posted On2014-05-09