Incidental Mutation 'R1673:Rasa4'
ID187798
Institutional Source Beutler Lab
Gene Symbol Rasa4
Ensembl Gene ENSMUSG00000004952
Gene NameRAS p21 protein activator 4
Synonyms
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.131) question?
Stock #R1673 (G1)
Quality Score198
Status Not validated
Chromosome5
Chromosomal Location136083916-136111860 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 136104637 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 650 (V650D)
Ref Sequence ENSEMBL: ENSMUSP00000037869 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042135] [ENSMUST00000100570]
Predicted Effect probably benign
Transcript: ENSMUST00000042135
AA Change: V650D

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000037869
Gene: ENSMUSG00000004952
AA Change: V650D

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 604 3.47e-139 SMART
PH 566 674 1.81e-11 SMART
BTK 674 710 3.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000100570
AA Change: V604D

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000098136
Gene: ENSMUSG00000004952
AA Change: V604D

DomainStartEndE-ValueType
C2 6 103 5.43e-17 SMART
C2 134 231 1.78e-21 SMART
RasGAP 243 558 3.48e-89 SMART
PH 520 628 1.81e-11 SMART
BTK 628 664 3.6e-4 SMART
Predicted Effect unknown
Transcript: ENSMUST00000122887
AA Change: V78D
SMART Domains Protein: ENSMUSP00000118929
Gene: ENSMUSG00000004952
AA Change: V78D

DomainStartEndE-ValueType
PH 6 103 1.36e-6 SMART
BTK 103 141 5.56e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125048
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135344
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140972
Predicted Effect probably benign
Transcript: ENSMUST00000145294
SMART Domains Protein: ENSMUSP00000120203
Gene: ENSMUSG00000004952

DomainStartEndE-ValueType
C2 5 68 1.88e-2 SMART
Blast:RasGAP 80 121 7e-20 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184713
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GAP1 family of GTPase-activating proteins that suppresses the Ras/mitogen-activated protein kinase pathway in response to Ca(2+). Stimuli that increase intracellular Ca(2+) levels result in the translocation of this protein to the plasma membrane, where it activates Ras GTPase activity. Consequently, Ras is converted from the active GTP-bound state to the inactive GDP-bound state and no longer activates downstream pathways that regulate gene expression, cell growth, and differentiation. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene display an increased sensitivity to bacterial infections which involves reduced phagocyte function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mcm2 A T 6: 88,892,078 L264Q probably benign Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Rasa4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01090:Rasa4 APN 5 136101993 missense possibly damaging 0.95
IGL01364:Rasa4 APN 5 136095571 missense possibly damaging 0.83
IGL01835:Rasa4 APN 5 136102607 missense possibly damaging 0.95
IGL02284:Rasa4 APN 5 136101691 critical splice donor site probably null
IGL02332:Rasa4 APN 5 136095599 missense probably benign 0.02
IGL03197:Rasa4 APN 5 136102012 missense probably damaging 1.00
R0729:Rasa4 UTSW 5 136102070 splice site probably benign
R0782:Rasa4 UTSW 5 136104532 missense possibly damaging 0.94
R1124:Rasa4 UTSW 5 136105656 missense probably benign 0.07
R1902:Rasa4 UTSW 5 136091238 missense probably benign 0.01
R2357:Rasa4 UTSW 5 136091247 missense probably damaging 1.00
R2427:Rasa4 UTSW 5 136102027 missense probably benign 0.24
R2880:Rasa4 UTSW 5 136091771 missense probably damaging 1.00
R3818:Rasa4 UTSW 5 136102293 missense possibly damaging 0.65
R4647:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R4782:Rasa4 UTSW 5 136091229 nonsense probably null
R4837:Rasa4 UTSW 5 136091810 critical splice donor site probably null
R4863:Rasa4 UTSW 5 136103911 nonsense probably null
R5020:Rasa4 UTSW 5 136101299 missense probably damaging 1.00
R5729:Rasa4 UTSW 5 136093162 missense probably benign
R6606:Rasa4 UTSW 5 136103947 missense probably damaging 1.00
R6750:Rasa4 UTSW 5 136100948 missense probably benign 0.12
R7009:Rasa4 UTSW 5 136101363 missense probably damaging 1.00
R7158:Rasa4 UTSW 5 136102021 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACTCTGGCTGAGATCCCTTCAC -3'
(R):5'- TTTCTAGGCATGAGACCCCAGGAC -3'

Sequencing Primer
(F):5'- ACTGTAAGTCCTAATGCCACCTG -3'
(R):5'- ACACAGCCTGCAGTACCTAA -3'
Posted On2014-05-09