Incidental Mutation 'R1673:Mcm2'
ID187800
Institutional Source Beutler Lab
Gene Symbol Mcm2
Ensembl Gene ENSMUSG00000002870
Gene Nameminichromosome maintenance complex component 2
SynonymsBM28, CDCL1, Mcmd2
MMRRC Submission 039709-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1673 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location88883474-88898780 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 88892078 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 264 (L264Q)
Ref Sequence ENSEMBL: ENSMUSP00000061923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058011] [ENSMUST00000205165]
Predicted Effect probably benign
Transcript: ENSMUST00000058011
AA Change: L264Q

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061923
Gene: ENSMUSG00000002870
AA Change: L264Q

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:MCM2_N 50 182 3.5e-20 PFAM
MCM 290 803 N/A SMART
Blast:MCM 816 891 3e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203172
Predicted Effect probably benign
Transcript: ENSMUST00000203935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204393
Predicted Effect probably benign
Transcript: ENSMUST00000205165
SMART Domains Protein: ENSMUSP00000145295
Gene: ENSMUSG00000002870

DomainStartEndE-ValueType
low complexity region 11 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.1%
  • 20x: 91.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre_RC) and may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein forms a complex with MCM4, 6, and 7, and has been shown to regulate the helicase activity of the complex. This protein is phosphorylated, and thus regulated by, protein kinases CDC2 and CDC7. Multiple alternatively spliced transcript variants have been found, but the full-length nature of some variants has not been defined. [provided by RefSeq, Oct 2012]
PHENOTYPE: Mice homozygous for non functional alleles at this locus die prematurely. There is an increased tumor incidence and abnormalities in a variety of systems in mice as they become moribund. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 T C 11: 110,212,339 S809G probably benign Het
Ap4b1 T A 3: 103,817,845 probably null Het
Aqp12 A G 1: 93,006,884 Q161R possibly damaging Het
Atp8a2 A G 14: 59,791,240 I926T probably benign Het
Cacna2d1 A T 5: 16,299,990 N314I probably damaging Het
Cd209d A G 8: 3,877,113 S81P probably damaging Het
Cdcp1 T A 9: 123,178,021 K554* probably null Het
Celsr1 A G 15: 85,932,457 Y1762H probably benign Het
Cklf A G 8: 104,257,351 T49A possibly damaging Het
Col12a1 T G 9: 79,693,538 I755L probably benign Het
Cts3 G A 13: 61,567,554 Q140* probably null Het
Ddx1 A T 12: 13,244,966 probably null Het
Dnah3 C A 7: 119,971,179 E2262* probably null Het
Dnah5 A G 15: 28,290,148 N1228S probably benign Het
Dsg1a G A 18: 20,331,504 R352Q probably damaging Het
Efcab5 A G 11: 77,151,853 F25L probably damaging Het
Efhd1 T A 1: 87,264,682 V78D probably damaging Het
Eif5a2 T C 3: 28,793,818 probably null Het
Elp2 T A 18: 24,611,926 V101D possibly damaging Het
Enpp2 A T 15: 54,910,196 probably null Het
F5 A G 1: 164,179,520 T298A probably damaging Het
Fam208b A G 13: 3,584,498 probably null Het
Fbxo21 G T 5: 118,008,064 R584L probably benign Het
Fbxw22 G T 9: 109,382,128 F368L possibly damaging Het
Gcn1l1 T C 5: 115,582,297 I409T probably benign Het
Gm10260 A T 13: 97,760,360 Y77N possibly damaging Het
Gm12887 T C 4: 121,616,458 Y65C probably damaging Het
Gria4 G A 9: 4,537,637 Q224* probably null Het
Hdac5 C T 11: 102,198,805 V860M probably damaging Het
Ino80 G A 2: 119,381,936 R1302C probably damaging Het
Kcns2 A T 15: 34,838,820 I110F probably damaging Het
Lrig3 A G 10: 126,010,167 T822A probably damaging Het
Mapk6 T C 9: 75,395,569 D214G probably damaging Het
Mpnd A T 17: 56,010,455 Y64F probably damaging Het
Muc1 T A 3: 89,231,772 M520K possibly damaging Het
Muc4 T A 16: 32,756,902 S189T probably benign Het
Myh13 T C 11: 67,352,119 S953P possibly damaging Het
Ncf2 A T 1: 152,830,479 M281L probably benign Het
Nipal2 A G 15: 34,648,695 I116T probably damaging Het
Nptn T C 9: 58,623,732 L46P probably benign Het
Olfr11 A T 13: 21,639,044 S160T probably damaging Het
Olfr1283 A G 2: 111,369,207 T192A probably benign Het
Olfr290 T A 7: 84,916,117 F113I probably damaging Het
Olfr610 C A 7: 103,506,689 V86F probably damaging Het
Pgr A T 9: 8,902,068 Y534F possibly damaging Het
Pip4k2a A T 2: 18,872,282 probably null Het
Pkd1l2 C G 8: 117,040,775 V1259L probably benign Het
Ppp1r12a A G 10: 108,249,565 E457G probably damaging Het
Rasa4 T A 5: 136,104,637 V650D probably benign Het
Rem2 C T 14: 54,476,309 probably benign Het
Sdc1 G A 12: 8,790,409 R62Q possibly damaging Het
Sdk1 A G 5: 141,948,506 E366G possibly damaging Het
Setd2 T A 9: 110,604,180 H2406Q probably damaging Het
Slc30a5 A G 13: 100,813,383 V397A probably benign Het
Slc36a2 A T 11: 55,184,913 L16H possibly damaging Het
Slc44a1 T C 4: 53,542,468 V334A probably benign Het
Sox8 A T 17: 25,567,482 Y416N possibly damaging Het
Speg T C 1: 75,411,163 V1416A possibly damaging Het
Stk24 T A 14: 121,337,571 I42F probably damaging Het
Tcerg1 T A 18: 42,552,581 L661Q possibly damaging Het
Tmem110 T C 14: 30,864,434 L72S possibly damaging Het
Tpp1 G A 7: 105,747,673 R417W probably damaging Het
Trim12a T A 7: 104,306,057 D153V possibly damaging Het
Trpm2 T C 10: 77,942,944 N396S probably benign Het
Ttn T C 2: 76,807,083 K5695R probably damaging Het
Ttn G A 2: 76,810,287 R11960C probably damaging Het
Tulp3 A C 6: 128,333,943 probably null Het
Uaca T A 9: 60,872,156 L1273H probably damaging Het
Usp33 A G 3: 152,368,282 E255G probably damaging Het
Vmn2r54 T G 7: 12,616,211 probably null Het
Vwa8 C T 14: 78,908,230 R116C probably damaging Het
Wnt5b A T 6: 119,446,354 F116L probably benign Het
Zbtb12 CTTCAT CTTCATTCAT 17: 34,896,308 probably null Het
Zbtb12 TCATC TCATCCATC 17: 34,896,310 probably null Het
Zfp408 G A 2: 91,646,008 T367I probably damaging Het
Zfp512b G A 2: 181,588,493 A480V possibly damaging Het
Zfp560 T C 9: 20,347,653 T638A probably benign Het
Zfp932 G T 5: 110,008,988 G151V probably damaging Het
Zpbp T C 11: 11,352,696 K320E probably damaging Het
Zranb2 C T 3: 157,537,640 P91L probably damaging Het
Other mutations in Mcm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mcm2 APN 6 88893401 missense probably benign 0.04
IGL01082:Mcm2 APN 6 88887877 missense probably benign 0.05
IGL01451:Mcm2 APN 6 88891966 splice site probably benign
IGL01534:Mcm2 APN 6 88887718 critical splice donor site probably null
IGL01670:Mcm2 APN 6 88887632 unclassified probably benign
IGL01724:Mcm2 APN 6 88886062 missense probably damaging 1.00
IGL01936:Mcm2 APN 6 88891726 missense probably damaging 1.00
IGL02082:Mcm2 APN 6 88888236 nonsense probably null
R0254:Mcm2 UTSW 6 88884016 missense probably damaging 0.99
R1740:Mcm2 UTSW 6 88884044 missense probably damaging 1.00
R1761:Mcm2 UTSW 6 88889788 missense possibly damaging 0.90
R1917:Mcm2 UTSW 6 88891803 missense possibly damaging 0.88
R2250:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2307:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2308:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2309:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R2379:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3431:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3432:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3878:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3911:Mcm2 UTSW 6 88888252 missense probably damaging 0.98
R3934:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R3936:Mcm2 UTSW 6 88893008 missense probably damaging 0.99
R4640:Mcm2 UTSW 6 88887804 missense possibly damaging 0.53
R4749:Mcm2 UTSW 6 88891991 missense possibly damaging 0.95
R5267:Mcm2 UTSW 6 88897450 missense probably benign
R5701:Mcm2 UTSW 6 88893091 missense probably damaging 1.00
R5872:Mcm2 UTSW 6 88884071 missense probably benign 0.05
R6118:Mcm2 UTSW 6 88887836 missense probably damaging 1.00
R6152:Mcm2 UTSW 6 88889909 critical splice acceptor site probably benign
R6207:Mcm2 UTSW 6 88885862 missense probably benign 0.00
R6550:Mcm2 UTSW 6 88886959 critical splice donor site probably null
R7184:Mcm2 UTSW 6 88891794 missense probably damaging 1.00
R7303:Mcm2 UTSW 6 88887946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCCAGTACAAAGTTGCAC -3'
(R):5'- TGACCCCAGCTATGTCATCAGTCC -3'

Sequencing Primer
(F):5'- ACTTGACCATGCTGAGCTG -3'
(R):5'- GCTATGTCATCAGTCCCACCC -3'
Posted On2014-05-09