Incidental Mutation 'R1674:Lama5'
ID187882
Institutional Source Beutler Lab
Gene Symbol Lama5
Ensembl Gene ENSMUSG00000015647
Gene Namelaminin, alpha 5
Synonyms
MMRRC Submission 039710-MU
Accession Numbers

Ncbi RefSeq: NM_001081171.2; MGI: 105382

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1674 (G1)
Quality Score193
Status Validated
Chromosome2
Chromosomal Location180176373-180225859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180201987 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 430 (V430A)
Ref Sequence ENSEMBL: ENSMUSP00000015791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015791]
PDB Structure
LAMININ ALPHA5 CHAIN N-TERMINAL FRAGMENT [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015791
AA Change: V430A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000015791
Gene: ENSMUSG00000015647
AA Change: V430A

DomainStartEndE-ValueType
signal peptide 1 40 N/A INTRINSIC
LamNT 44 303 1.06e-132 SMART
EGF_Lam 305 361 4.35e-6 SMART
EGF_Lam 364 431 5.78e-11 SMART
EGF_Lam 434 476 1.32e-5 SMART
EGF_Lam 500 544 8.63e-10 SMART
EGF_Lam 547 590 1.16e-10 SMART
EGF_Lam 593 635 4.63e-10 SMART
EGF_Lam 638 680 6.25e-7 SMART
EGF_Lam 683 726 3.1e-11 SMART
EGF_Lam 730 779 2.99e-4 SMART
EGF_Lam 782 831 4.66e-6 SMART
EGF_Lam 834 878 3.48e-5 SMART
low complexity region 1261 1273 N/A INTRINSIC
EGF_Lam 1443 1486 7.01e-10 SMART
EGF_like 1489 1530 3.64e-1 SMART
EGF_Lam 1533 1579 8.56e-14 SMART
EGF_Lam 1582 1630 1.86e-14 SMART
LamB 1689 1819 5.86e-61 SMART
EGF_like 1818 1862 2.74e0 SMART
EGF_Lam 1865 1912 3.32e-11 SMART
EGF_Lam 1915 1968 1.61e-9 SMART
EGF_Lam 1971 2022 6.39e-13 SMART
EGF_Lam 2025 2069 1.94e-12 SMART
EGF_Lam 2072 2116 1.35e-11 SMART
EGF_like 2103 2145 3.1e1 SMART
EGF_Lam 2119 2166 1.18e-2 SMART
Pfam:Laminin_I 2189 2453 1.7e-65 PFAM
low complexity region 2532 2548 N/A INTRINSIC
low complexity region 2557 2569 N/A INTRINSIC
low complexity region 2632 2641 N/A INTRINSIC
low complexity region 2663 2676 N/A INTRINSIC
LamG 2760 2912 3.97e-8 SMART
LamG 2966 3103 1.78e-10 SMART
LamG 3149 3274 1.11e-20 SMART
LamG 3359 3497 4.05e-23 SMART
LamG 3539 3670 3e-26 SMART
Meta Mutation Damage Score 0.032 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 100% (91/91)
MGI Phenotype Strain: 3624772; 1934917
Lethality: E1-E17
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the vertebrate laminin alpha chains. Laminins, a family of extracellular matrix glycoproteins, are the major noncollagenous constituent of basement membranes. They have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Laminins are composed of 3 non identical chains: laminin alpha, beta and gamma (formerly A, B1, and B2, respectively) and they form a cruciform structure consisting of 3 short arms, each formed by a different chain, and a long arm composed of all 3 chains. Each laminin chain is a multidomain protein encoded by a distinct gene. The protein encoded by this gene is the alpha-5 subunit of of laminin-10 (laminin-511), laminin-11 (laminin-521) and laminin-15 (laminin-523). [provided by RefSeq, Jun 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit disrupted basal laminae leading to exencephaly, syndactyly, placentopathy, kidney defects, abnormal lobar septation with absence of a visceral pleural membrane, and lethality in late gestation. [provided by MGI curators]
Allele List at MGI

All alleles(49) : Targeted(5) Gene trapped(44)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579G24Rik A G 3: 79,631,144 T66A probably benign Het
5430401F13Rik A T 6: 131,552,803 Q120L unknown Het
Akirin1 A G 4: 123,743,463 S110P possibly damaging Het
Ankmy2 T A 12: 36,187,669 S256T probably benign Het
Areg T C 5: 91,143,626 F143L probably damaging Het
Arhgap42 A G 9: 9,006,584 S604P probably damaging Het
Arid1a A G 4: 133,689,260 V1068A unknown Het
Arid4a G A 12: 71,075,338 S509N probably benign Het
Atoh1 T G 6: 64,729,930 I203S possibly damaging Het
Atp5l T C 9: 44,914,659 T69A possibly damaging Het
Baz1b A G 5: 135,205,111 E164G probably damaging Het
Baz2b A T 2: 59,912,992 V1545E possibly damaging Het
Best1 A G 19: 9,993,226 probably null Het
Casp8 T A 1: 58,844,416 I314N probably damaging Het
Ccdc13 T C 9: 121,809,142 T26A probably damaging Het
Ccr6 A T 17: 8,256,217 I85L probably damaging Het
Cdh10 A T 15: 18,985,066 N272I probably benign Het
Cdh10 T A 15: 19,013,330 I672K probably damaging Het
Cdk17 A T 10: 93,221,630 E163V probably benign Het
Chsy1 T C 7: 66,171,663 F549L probably damaging Het
CN725425 T C 15: 91,246,921 Y420H possibly damaging Het
Cpt1b A T 15: 89,422,332 M281K possibly damaging Het
Crlf2 A G 5: 109,558,803 probably null Het
Ctif T C 18: 75,637,180 T45A probably benign Het
Ddx31 T C 2: 28,858,816 F252S probably damaging Het
Dennd2d T C 3: 106,492,517 I242T probably benign Het
Dennd5b A G 6: 148,998,284 F1205S probably damaging Het
Dopey1 T C 9: 86,536,160 S1981P probably damaging Het
Dsg1b A T 18: 20,399,521 T541S probably benign Het
Dst T A 1: 34,223,795 probably null Het
Dysf T C 6: 84,179,715 V1508A probably benign Het
Erf A T 7: 25,245,306 L200Q possibly damaging Het
Erich3 A G 3: 154,762,623 probably benign Het
Esrrb C T 12: 86,514,451 L320F probably damaging Het
Fap T A 2: 62,519,005 D508V probably benign Het
Fdft1 A C 14: 63,164,585 N48K probably benign Het
Fdps A G 3: 89,100,730 V94A probably benign Het
Fes A T 7: 80,377,938 H819Q probably benign Het
Foxd1 G T 13: 98,354,839 D74Y unknown Het
Gm136 A T 4: 34,746,662 probably benign Het
Gm14685 G T X: 73,127,655 G218C probably damaging Het
Gm5919 T A 9: 83,883,285 L58* probably null Het
Gm6871 C T 7: 41,573,635 V10I possibly damaging Het
Isy1 T C 6: 87,834,487 R29G probably damaging Het
Kif16b T A 2: 142,712,953 K653* probably null Het
Kif17 A G 4: 138,301,258 T706A probably benign Het
Kif18b G T 11: 102,913,060 P425T probably benign Het
Lama1 T A 17: 67,791,244 V1812E probably benign Het
Lclat1 A G 17: 73,239,781 E231G probably damaging Het
Lig4 T C 8: 9,971,692 D696G probably benign Het
Mylpf T A 7: 127,214,137 V151E probably damaging Het
Naa16 A T 14: 79,387,057 M1K probably null Het
Ndufaf6 T C 4: 11,070,264 K119R probably benign Het
Nt5c1b T C 12: 10,370,055 probably benign Het
Olfr1080 T A 2: 86,553,860 D88V probably damaging Het
Olfr1102 T C 2: 87,002,233 V88A probably benign Het
Olfr1197 A G 2: 88,729,257 V114A probably damaging Het
Olfr1504 T A 19: 13,887,590 I207L probably benign Het
Olfr307 G A 7: 86,335,557 P280S probably damaging Het
Otud4 A G 8: 79,673,147 N830S probably benign Het
Pdcd10 A C 3: 75,541,179 M26R probably damaging Het
Pitpnc1 A G 11: 107,226,245 V223A possibly damaging Het
Pkp2 A G 16: 16,240,558 D368G possibly damaging Het
Pla1a A T 16: 38,414,810 M174K probably benign Het
Polr2b A G 5: 77,326,623 K436E possibly damaging Het
Rdh16 A G 10: 127,801,357 M54V probably benign Het
Sall2 C A 14: 52,313,836 C632F probably damaging Het
Sart1 T A 19: 5,385,825 I120F probably damaging Het
Slco1a1 A T 6: 141,935,935 M157K probably damaging Het
Snapc4 T C 2: 26,376,197 T178A probably benign Het
Sox6 T C 7: 115,801,419 I63V probably benign Het
Spin1 T A 13: 51,149,099 Y243N probably damaging Het
Stmnd1 T C 13: 46,299,621 Y258H possibly damaging Het
Tex13b A T X: 140,810,070 N184K probably benign Het
Tgm5 T C 2: 121,071,544 T215A possibly damaging Het
Tnks2 A G 19: 36,871,622 T165A probably benign Het
Top2a A T 11: 99,009,273 F667Y probably damaging Het
Tpo T C 12: 30,100,568 M438V probably benign Het
Tyw1 A G 5: 130,269,328 R237G probably benign Het
Unc5c G A 3: 141,757,837 V240I possibly damaging Het
Unc80 A C 1: 66,509,308 T580P probably damaging Het
Upp2 G A 2: 58,790,064 E301K probably benign Het
Utp18 A G 11: 93,876,053 probably null Het
Vmn1r23 T C 6: 57,926,061 D244G possibly damaging Het
Vps13c T A 9: 67,853,703 L51* probably null Het
Xpnpep3 A G 15: 81,430,767 T223A probably benign Het
Zfp28 T A 7: 6,394,943 H792Q possibly damaging Het
Zfp804a A G 2: 82,258,824 K999R probably benign Het
Zkscan16 G A 4: 58,948,918 V158M possibly damaging Het
Other mutations in Lama5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Lama5 APN 2 180176543 unclassified probably benign
IGL01370:Lama5 APN 2 180197400 missense possibly damaging 0.87
IGL01474:Lama5 APN 2 180196570 missense probably damaging 1.00
IGL01614:Lama5 APN 2 180180864 missense probably damaging 1.00
IGL01941:Lama5 APN 2 180192392 missense possibly damaging 0.71
IGL01953:Lama5 APN 2 180190704 missense probably damaging 0.97
IGL02093:Lama5 APN 2 180188587 missense probably damaging 1.00
IGL02197:Lama5 APN 2 180207219 missense possibly damaging 0.82
IGL02308:Lama5 APN 2 180190327 splice site probably benign
IGL02314:Lama5 APN 2 180194482 splice site probably benign
IGL02317:Lama5 APN 2 180191319 missense probably damaging 1.00
IGL02354:Lama5 APN 2 180193884 nonsense probably null
IGL02361:Lama5 APN 2 180193884 nonsense probably null
IGL02557:Lama5 APN 2 180190932 nonsense probably null
IGL03026:Lama5 APN 2 180195967 missense probably benign 0.34
IGL03160:Lama5 APN 2 180180335 missense probably damaging 1.00
IGL03238:Lama5 APN 2 180188574 missense probably benign
IGL03390:Lama5 APN 2 180207218 missense probably damaging 1.00
Salty UTSW 2 180181651 missense possibly damaging 0.84
PIT4378001:Lama5 UTSW 2 180189445 missense possibly damaging 0.89
R0003:Lama5 UTSW 2 180178079 unclassified probably null
R0056:Lama5 UTSW 2 180187106 intron probably benign
R0147:Lama5 UTSW 2 180190406 missense probably benign
R0148:Lama5 UTSW 2 180190406 missense probably benign
R0310:Lama5 UTSW 2 180181566 splice site probably benign
R0326:Lama5 UTSW 2 180182426 missense possibly damaging 0.90
R0368:Lama5 UTSW 2 180181230 nonsense probably null
R0479:Lama5 UTSW 2 180184457 missense probably benign 0.03
R0490:Lama5 UTSW 2 180180169 missense possibly damaging 0.90
R0636:Lama5 UTSW 2 180189331 critical splice donor site probably null
R0704:Lama5 UTSW 2 180179484 missense possibly damaging 0.84
R0733:Lama5 UTSW 2 180180718 missense possibly damaging 0.83
R1017:Lama5 UTSW 2 180195420 missense probably damaging 1.00
R1078:Lama5 UTSW 2 180179764 unclassified probably benign
R1294:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1423:Lama5 UTSW 2 180195641 missense probably damaging 1.00
R1438:Lama5 UTSW 2 180182800 missense probably benign 0.01
R1447:Lama5 UTSW 2 180185878 missense probably damaging 0.99
R1540:Lama5 UTSW 2 180180151 missense probably benign
R1601:Lama5 UTSW 2 180197745 missense probably damaging 1.00
R1624:Lama5 UTSW 2 180206758 missense probably benign 0.02
R1687:Lama5 UTSW 2 180194066 missense probably benign 0.00
R1696:Lama5 UTSW 2 180202486 missense probably damaging 1.00
R1701:Lama5 UTSW 2 180221369 missense probably damaging 1.00
R1778:Lama5 UTSW 2 180195481 splice site probably benign
R1936:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1939:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1940:Lama5 UTSW 2 180190921 missense probably benign 0.00
R1953:Lama5 UTSW 2 180190747 missense possibly damaging 0.94
R1966:Lama5 UTSW 2 180188352 missense probably damaging 1.00
R2024:Lama5 UTSW 2 180179130 missense probably benign 0.00
R2079:Lama5 UTSW 2 180225508 missense possibly damaging 0.68
R2115:Lama5 UTSW 2 180186885 missense probably damaging 1.00
R2173:Lama5 UTSW 2 180196242 missense probably benign 0.00
R2272:Lama5 UTSW 2 180178603 missense possibly damaging 0.93
R2357:Lama5 UTSW 2 180180097 missense probably benign 0.01
R2860:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2861:Lama5 UTSW 2 180187247 missense probably benign 0.00
R2939:Lama5 UTSW 2 180198954 missense probably damaging 1.00
R3053:Lama5 UTSW 2 180183067 missense probably damaging 0.99
R3430:Lama5 UTSW 2 180196317 missense probably benign 0.00
R3752:Lama5 UTSW 2 180187222 missense probably damaging 1.00
R3782:Lama5 UTSW 2 180194563 missense possibly damaging 0.57
R3901:Lama5 UTSW 2 180182351 splice site probably benign
R4248:Lama5 UTSW 2 180180427 missense possibly damaging 0.84
R4626:Lama5 UTSW 2 180184460 missense probably damaging 0.98
R4638:Lama5 UTSW 2 180190413 missense possibly damaging 0.89
R4669:Lama5 UTSW 2 180180637 missense probably damaging 1.00
R4673:Lama5 UTSW 2 180199266 missense probably damaging 1.00
R4677:Lama5 UTSW 2 180179366 missense possibly damaging 0.69
R4701:Lama5 UTSW 2 180191696 missense probably damaging 1.00
R4774:Lama5 UTSW 2 180185941 missense probably damaging 1.00
R4880:Lama5 UTSW 2 180177068 unclassified probably benign
R4923:Lama5 UTSW 2 180184149 missense probably benign 0.18
R4960:Lama5 UTSW 2 180208252 critical splice donor site probably null
R4983:Lama5 UTSW 2 180193449 missense probably benign 0.13
R5061:Lama5 UTSW 2 180198786 nonsense probably null
R5080:Lama5 UTSW 2 180207200 nonsense probably null
R5135:Lama5 UTSW 2 180202220 missense possibly damaging 0.89
R5206:Lama5 UTSW 2 180191304 missense probably damaging 1.00
R5296:Lama5 UTSW 2 180193801 missense probably damaging 1.00
R5319:Lama5 UTSW 2 180181118 missense probably damaging 1.00
R5355:Lama5 UTSW 2 180181651 missense possibly damaging 0.84
R5388:Lama5 UTSW 2 180190746 missense possibly damaging 0.83
R5528:Lama5 UTSW 2 180194563 missense probably benign 0.21
R5536:Lama5 UTSW 2 180189349 missense probably damaging 0.99
R5658:Lama5 UTSW 2 180208276 nonsense probably null
R5823:Lama5 UTSW 2 180192492 missense probably benign 0.04
R5885:Lama5 UTSW 2 180201831 missense probably damaging 1.00
R5889:Lama5 UTSW 2 180193674 intron probably benign
R5912:Lama5 UTSW 2 180195475 missense probably damaging 1.00
R5955:Lama5 UTSW 2 180197474 missense probably damaging 1.00
R6015:Lama5 UTSW 2 180185392 missense probably benign 0.36
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6037:Lama5 UTSW 2 180207013 missense probably damaging 1.00
R6191:Lama5 UTSW 2 180180611 missense probably damaging 0.98
R6191:Lama5 UTSW 2 180185959 missense probably damaging 1.00
R6359:Lama5 UTSW 2 180195982 missense probably benign 0.01
R6385:Lama5 UTSW 2 180196533 missense probably damaging 1.00
R6406:Lama5 UTSW 2 180197464 nonsense probably null
R6552:Lama5 UTSW 2 180181154 missense probably damaging 0.98
R6632:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6633:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6645:Lama5 UTSW 2 180179670 missense probably damaging 1.00
R6731:Lama5 UTSW 2 180188574 missense probably benign 0.09
R6744:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6798:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6799:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6801:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6851:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6869:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6881:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6882:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R6884:Lama5 UTSW 2 180191662 missense probably damaging 1.00
R7022:Lama5 UTSW 2 180180731 missense probably damaging 1.00
R7204:Lama5 UTSW 2 180202177 missense probably damaging 1.00
R7207:Lama5 UTSW 2 180207084 missense probably damaging 0.98
R7282:Lama5 UTSW 2 180201795 missense probably damaging 1.00
R7367:Lama5 UTSW 2 180192958 missense probably benign 0.01
R7410:Lama5 UTSW 2 180202390 critical splice donor site probably null
X0065:Lama5 UTSW 2 180181731 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- TCAAGTCTTCACAGGTCCCATCCG -3'
(R):5'- TGCCTACGACTGTTACTACGACCC -3'

Sequencing Primer
(F):5'- TCCGTGAAGTCTGACTCACAG -3'
(R):5'- ACTGTTACTACGACCCTGAGG -3'
Posted On2014-05-09