Incidental Mutation 'R1675:Adamtsl2'
List |< first << previous [record 53 of 1259] next >> last >|
ID187972
Institutional Source Beutler Lab
Gene Symbol Adamtsl2
Ensembl Gene ENSMUSG00000036040
Gene NameADAMTS-like 2
SynonymsA930008K15Rik
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1675 (G1)
Quality Score154
Status Not validated
Chromosome2
Chromosomal Location27079379-27108981 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GC to G at 27082485 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000088774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091233]
Predicted Effect probably null
Transcript: ENSMUST00000091233
SMART Domains Protein: ENSMUSP00000088774
Gene: ENSMUSG00000036040

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TSP1 50 106 5.14e-7 SMART
Pfam:ADAM_spacer1 214 331 5.4e-28 PFAM
low complexity region 345 358 N/A INTRINSIC
TSP1 573 629 8.15e-1 SMART
TSP1 631 692 1.85e-2 SMART
TSP1 694 744 4.15e-1 SMART
TSP1 747 796 9.98e-5 SMART
TSP1 803 861 4.95e-2 SMART
TSP1 863 914 2.53e-6 SMART
Pfam:PLAC 922 953 1.4e-12 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous null mice die shortly after birth, are cyanotic and exhibit respiratory distress. Severe bronchial epithelial dysplasia with abnormal glycogen-rich inclusions in the bronchial epithelium is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lilrb4a A G 10: 51,496,185 T222A probably benign Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Adamtsl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00423:Adamtsl2 APN 2 27085088 missense probably damaging 1.00
IGL01902:Adamtsl2 APN 2 27087252 missense probably damaging 1.00
IGL02207:Adamtsl2 APN 2 27102981 missense probably damaging 0.99
IGL02247:Adamtsl2 APN 2 27084893 missense probably damaging 1.00
IGL02253:Adamtsl2 APN 2 27098697 missense possibly damaging 0.48
IGL02655:Adamtsl2 APN 2 27082530 splice site probably benign
IGL03148:Adamtsl2 APN 2 27084059 missense probably damaging 0.99
IGL03269:Adamtsl2 APN 2 27108355 nonsense probably null
R0609:Adamtsl2 UTSW 2 27089635 missense probably benign 0.25
R1183:Adamtsl2 UTSW 2 27084080 missense probably damaging 1.00
R1443:Adamtsl2 UTSW 2 27103066 missense possibly damaging 0.89
R1698:Adamtsl2 UTSW 2 27103127 missense possibly damaging 0.92
R1765:Adamtsl2 UTSW 2 27102830 missense probably benign 0.01
R1934:Adamtsl2 UTSW 2 27089593 missense probably damaging 0.99
R2106:Adamtsl2 UTSW 2 27102825 missense probably benign 0.02
R2108:Adamtsl2 UTSW 2 27095558 missense probably benign
R2189:Adamtsl2 UTSW 2 27081738 missense probably benign 0.00
R2232:Adamtsl2 UTSW 2 27103178 missense probably damaging 1.00
R4301:Adamtsl2 UTSW 2 27087283 missense probably null 1.00
R4518:Adamtsl2 UTSW 2 27095547 missense probably benign 0.00
R4572:Adamtsl2 UTSW 2 27083256 missense probably damaging 0.99
R4627:Adamtsl2 UTSW 2 27093585 missense probably damaging 0.99
R4668:Adamtsl2 UTSW 2 27095475 missense probably benign 0.00
R4686:Adamtsl2 UTSW 2 27093825 missense probably damaging 0.99
R4821:Adamtsl2 UTSW 2 27098592 splice site probably null
R5054:Adamtsl2 UTSW 2 27101720 missense probably damaging 1.00
R5460:Adamtsl2 UTSW 2 27095398 splice site probably null
R5569:Adamtsl2 UTSW 2 27102833 missense probably damaging 1.00
R5694:Adamtsl2 UTSW 2 27081724 missense probably benign 0.03
R6836:Adamtsl2 UTSW 2 27081706 start codon destroyed probably null 0.90
X0003:Adamtsl2 UTSW 2 27081772 small deletion probably benign
X0003:Adamtsl2 UTSW 2 27081773 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGTCCAATAGGAAGCTGCCTCATC -3'
(R):5'- AGTGGCAAAGCCCTATAAACAGTCC -3'

Sequencing Primer
(F):5'- GAAGCTGCCTCATCCTCTTTC -3'
(R):5'- AAGGACTTGTCAGAAGCTCTC -3'
Posted On2014-05-09