Incidental Mutation 'R1675:Lilrb4a'
ID188006
Institutional Source Beutler Lab
Gene Symbol Lilrb4a
Ensembl Gene ENSMUSG00000112148
Gene Nameleukocyte immunoglobulin-like receptor, subfamily B, member 4A
SynonymsLilrb4, CD85K, ILT3, HM18, Gp49b
MMRRC Submission 039711-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.156) question?
Stock #R1675 (G1)
Quality Score212
Status Not validated
Chromosome10
Chromosomal Location51490956-51496611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51496185 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 222 (T222A)
Ref Sequence ENSEMBL: ENSMUSP00000151225 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078778] [ENSMUST00000217705] [ENSMUST00000217706] [ENSMUST00000218123] [ENSMUST00000218617] [ENSMUST00000219696] [ENSMUST00000220182] [ENSMUST00000220226]
Predicted Effect probably benign
Transcript: ENSMUST00000078778
AA Change: T317A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000077833
Gene: ENSMUSG00000112148
AA Change: T317A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105481
AA Change: T317A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000101121
Gene: ENSMUSG00000062593
AA Change: T317A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
transmembrane domain 239 261 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000101122
Gene: ENSMUSG00000062593
AA Change: T278A

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG_like 28 118 4.91e1 SMART
IG_like 129 219 1.84e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000217705
AA Change: T222A

PolyPhen 2 Score 0.370 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000217706
AA Change: T278A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000218123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218413
Predicted Effect probably benign
Transcript: ENSMUST00000218617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218753
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219029
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219175
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219388
Predicted Effect probably benign
Transcript: ENSMUST00000219696
AA Change: T317A

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219828
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220166
Predicted Effect probably benign
Transcript: ENSMUST00000220182
AA Change: T278A

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000220226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220402
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit increased sensitivity to IgE-dependent passive cutaneous anaphylaxis and a reduced threshold for antigen challenge in active cutaneous anaphylaxis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 C T 1: 71,263,411 probably null Het
Adam6b T C 12: 113,491,044 Y494H probably benign Het
Adamtsl2 GC G 2: 27,082,485 probably null Het
Anapc2 G A 2: 25,272,639 V42M possibly damaging Het
Aph1a T A 3: 95,894,899 D64E possibly damaging Het
Arhgef11 C T 3: 87,731,211 A1111V possibly damaging Het
Atoh1 T C 6: 64,730,157 S279P probably benign Het
Atp10b A G 11: 43,225,648 T941A probably damaging Het
Barhl1 C T 2: 28,915,411 R90Q possibly damaging Het
Calr3 T C 8: 72,431,458 D91G probably damaging Het
Ccdc148 T C 2: 58,980,554 D317G probably damaging Het
Cnn3 C T 3: 121,457,169 Q19* probably null Het
Cul5 T C 9: 53,646,683 D207G probably benign Het
Cyp4x1 T C 4: 115,127,560 E41G possibly damaging Het
Dagla T A 19: 10,269,323 M138L probably benign Het
Dnah6 A T 6: 73,129,540 M1738K probably damaging Het
Eif4enif1 T A 11: 3,215,686 S88T probably benign Het
Eno3 T C 11: 70,658,666 probably null Het
Erbb3 C A 10: 128,571,204 S1029I probably damaging Het
Erbin C A 13: 103,841,178 V624L probably damaging Het
Fam170b C T 14: 32,835,402 Q65* probably null Het
Fam208b T C 13: 3,569,507 I2241M possibly damaging Het
Gin1 T A 1: 97,786,055 L360* probably null Het
Gldc A T 19: 30,143,453 D359E probably damaging Het
Gpr107 A T 2: 31,167,051 T52S possibly damaging Het
Hip1r A G 5: 123,994,820 Y227C probably damaging Het
Hmgxb3 A G 18: 61,135,559 L1004P probably damaging Het
Hspa1l A G 17: 34,977,443 N153D probably damaging Het
Itga8 C A 2: 12,200,163 V488L probably damaging Het
Kcnk10 G A 12: 98,496,288 A134V probably benign Het
Kif18a T A 2: 109,298,403 C406S probably benign Het
Klhl28 A T 12: 64,951,819 S300R probably damaging Het
Kmt2e C T 5: 23,482,453 Q434* probably null Het
Lipn G A 19: 34,080,710 R277Q probably damaging Het
Lrrc61 G A 6: 48,568,774 R177Q possibly damaging Het
Lrrc74a G A 12: 86,741,026 E144K probably damaging Het
Mal T C 2: 127,635,044 Y77C probably benign Het
Map1a T A 2: 121,302,655 C1079* probably null Het
Mbd5 T A 2: 49,256,218 S147T possibly damaging Het
Nsd2 T A 5: 33,861,149 M509K probably benign Het
Olfr1342 C T 4: 118,689,948 R168H probably benign Het
Olfr262 C T 19: 12,240,831 V277I probably benign Het
Olfr414 T C 1: 174,431,097 V223A probably benign Het
Olfr51 T C 11: 51,007,637 F222L probably benign Het
Rcor2 C T 19: 7,270,181 L45F probably damaging Het
Rpl12 T A 2: 32,963,525 D107E probably benign Het
Rpl7l1 A T 17: 46,778,191 F205I probably damaging Het
Samd4b C T 7: 28,414,010 G177R probably damaging Het
Sema4a A T 3: 88,454,766 F18I possibly damaging Het
Slc37a1 A T 17: 31,338,074 T405S probably damaging Het
Snrnp40 C G 4: 130,378,043 probably null Het
Syt14 T C 1: 192,897,482 D781G probably damaging Het
Tprn T G 2: 25,264,409 D574E probably benign Het
Trim75 T A 8: 64,982,511 E429V probably damaging Het
Trit1 C T 4: 123,054,236 R450C possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc13c A G 9: 73,639,050 probably null Het
Usp49 C A 17: 47,673,410 L447I probably damaging Het
Vmn1r20 T C 6: 57,431,952 C88R probably benign Het
Zfp94 T A 7: 24,302,834 K394N probably damaging Het
Other mutations in Lilrb4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01399:Lilrb4a APN 10 51494065 missense probably benign 0.42
IGL02057:Lilrb4a APN 10 51492007 missense possibly damaging 0.81
IGL02386:Lilrb4a APN 10 51491226 nonsense probably null
IGL02999:Lilrb4a APN 10 51494143 missense probably damaging 1.00
IGL03292:Lilrb4a APN 10 51494846 unclassified probably null
IGL03382:Lilrb4a APN 10 51491520 missense probably benign 0.10
R0276:Lilrb4a UTSW 10 51491581 missense probably benign 0.01
R0470:Lilrb4a UTSW 10 51494827 missense possibly damaging 0.87
R1459:Lilrb4a UTSW 10 51491587 missense probably benign 0.44
R1819:Lilrb4a UTSW 10 51496028 missense probably damaging 1.00
R1914:Lilrb4a UTSW 10 51491949 missense probably benign 0.04
R2265:Lilrb4a UTSW 10 51491537 nonsense probably null
R2338:Lilrb4a UTSW 10 51491700 missense probably benign 0.13
R2884:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R2886:Lilrb4a UTSW 10 51491613 missense probably benign 0.01
R4322:Lilrb4a UTSW 10 51491611 missense probably damaging 1.00
R4624:Lilrb4a UTSW 10 51491488 missense probably damaging 1.00
R4923:Lilrb4a UTSW 10 51492043 missense possibly damaging 0.67
R5001:Lilrb4a UTSW 10 51491420 splice site probably null
R5262:Lilrb4a UTSW 10 51493207 critical splice donor site probably null
R6224:Lilrb4a UTSW 10 51491649 missense probably damaging 1.00
R7447:Lilrb4a UTSW 10 51491053 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CAGGTAAAACCCTCCAGGCTTCAG -3'
(R):5'- TGAGTTACCATCATGCAGGGCCAG -3'

Sequencing Primer
(F):5'- CTCCAGGCTTCAGAAGGTAG -3'
(R):5'- CACATGAGGTATTCATGATGGC -3'
Posted On2014-05-09