Incidental Mutation 'R1678:Sctr'
ID188240
Institutional Source Beutler Lab
Gene Symbol Sctr
Ensembl Gene ENSMUSG00000026387
Gene Namesecretin receptor
Synonyms6530402O03Rik
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.143) question?
Stock #R1678 (G1)
Quality Score215
Status Not validated
Chromosome1
Chromosomal Location120006894-120063536 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 120036439 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000139932 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072886] [ENSMUST00000189037]
Predicted Effect probably null
Transcript: ENSMUST00000072886
SMART Domains Protein: ENSMUSP00000072660
Gene: ENSMUSG00000026387

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 76 146 5.18e-21 SMART
Pfam:7tm_2 153 398 3.8e-88 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000189037
SMART Domains Protein: ENSMUSP00000139932
Gene: ENSMUSG00000026387

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 36 53 N/A INTRINSIC
HormR 61 131 2.59e-21 SMART
Pfam:7tm_2 138 383 1.9e-89 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a G protein-coupled receptor and belongs to the glucagon-VIP-secretin receptor family. It binds secretin which is the most potent regulator of pancreatic bicarbonate, electrolyte and volume secretion. Secretin and its receptor are suggested to be involved in pancreatic cancer and autism. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show polydipsia, polyuria, decreased urine osmolality, higher serum glucose levels, kidney glomerular and tubular pathology, and impaired renal water reabsorption. Homozygotes for a different null allele show impaired synaptic plasticity and social behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Sctr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Sctr APN 1 120044720 missense probably damaging 1.00
IGL01542:Sctr APN 1 120044769 splice site probably benign
IGL02798:Sctr APN 1 120022180 missense probably damaging 1.00
IGL02850:Sctr APN 1 120044663 missense possibly damaging 0.95
IGL02850:Sctr APN 1 120022179 missense probably damaging 1.00
IGL03256:Sctr APN 1 120031559 splice site probably benign
R0018:Sctr UTSW 1 120043556 splice site probably benign
R0166:Sctr UTSW 1 120055394 missense probably damaging 0.97
R1728:Sctr UTSW 1 120031656 missense probably benign 0.00
R1728:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1729:Sctr UTSW 1 120031656 missense probably benign 0.00
R1729:Sctr UTSW 1 120063246 missense probably benign 0.16
R1729:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1730:Sctr UTSW 1 120031656 missense probably benign 0.00
R1730:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1739:Sctr UTSW 1 120031656 missense probably benign 0.00
R1739:Sctr UTSW 1 120063246 missense probably benign 0.16
R1739:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1762:Sctr UTSW 1 120031656 missense probably benign 0.00
R1762:Sctr UTSW 1 120063246 missense probably benign 0.16
R1762:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R1783:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120031656 missense probably benign 0.00
R1785:Sctr UTSW 1 120063246 missense probably benign 0.16
R1785:Sctr UTSW 1 120063257 missense possibly damaging 0.67
R2116:Sctr UTSW 1 120031582 missense probably damaging 1.00
R5522:Sctr UTSW 1 120036416 missense probably benign 0.10
R5776:Sctr UTSW 1 120056407 missense probably damaging 1.00
R5781:Sctr UTSW 1 120031620 missense probably damaging 0.99
R6333:Sctr UTSW 1 120056452 missense probably damaging 1.00
X0067:Sctr UTSW 1 120007299 missense probably benign
Z1088:Sctr UTSW 1 120036406 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GAAGTCAAGTCCTCTGCATCCACC -3'
(R):5'- ACAAACCTTGTGTTCTGTGCTCCAC -3'

Sequencing Primer
(F):5'- ccaaccctcttcctccatttac -3'
(R):5'- GTGCTCCACTCCCTGTGAG -3'
Posted On2014-05-09