Incidental Mutation 'R1678:Dnm2'
ID188279
Institutional Source Beutler Lab
Gene Symbol Dnm2
Ensembl Gene ENSMUSG00000033335
Gene Namedynamin 2
Synonymsb2b2159Clo, Dyn2
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location21424908-21507759 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21467532 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 129 (V129A)
Ref Sequence ENSEMBL: ENSMUSP00000111063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072362] [ENSMUST00000091087] [ENSMUST00000115404] [ENSMUST00000165766] [ENSMUST00000172482] [ENSMUST00000173397] [ENSMUST00000174828]
Predicted Effect possibly damaging
Transcript: ENSMUST00000072362
AA Change: V129A

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000072199
Gene: ENSMUSG00000033335
AA Change: V129A

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091087
AA Change: V129A

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000088616
Gene: ENSMUSG00000033335
AA Change: V129A

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 516 623 8e-13 SMART
GED 644 735 2.57e-28 SMART
low complexity region 736 748 N/A INTRINSIC
low complexity region 773 795 N/A INTRINSIC
low complexity region 827 860 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115404
AA Change: V129A

PolyPhen 2 Score 0.892 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000111063
Gene: ENSMUSG00000033335
AA Change: V129A

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165766
AA Change: V129A

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000128961
Gene: ENSMUSG00000033335
AA Change: V129A

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 858 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169194
Predicted Effect possibly damaging
Transcript: ENSMUST00000172482
AA Change: V129A

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000133564
Gene: ENSMUSG00000033335
AA Change: V129A

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 864 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000173397
AA Change: V129A

PolyPhen 2 Score 0.863 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134243
Gene: ENSMUSG00000033335
AA Change: V129A

DomainStartEndE-ValueType
DYNc 6 245 1.01e-193 SMART
low complexity region 298 313 N/A INTRINSIC
PH 520 627 8e-13 SMART
GED 648 739 2.57e-28 SMART
low complexity region 740 752 N/A INTRINSIC
low complexity region 777 799 N/A INTRINSIC
low complexity region 831 863 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000174050
AA Change: V79A
SMART Domains Protein: ENSMUSP00000134696
Gene: ENSMUSG00000033335
AA Change: V79A

DomainStartEndE-ValueType
DYNc 1 196 8.6e-138 SMART
low complexity region 249 264 N/A INTRINSIC
PH 467 574 8e-13 SMART
GED 595 686 2.57e-28 SMART
low complexity region 687 699 N/A INTRINSIC
low complexity region 724 746 N/A INTRINSIC
low complexity region 778 805 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174828
SMART Domains Protein: ENSMUSP00000133961
Gene: ENSMUSG00000033335

DomainStartEndE-ValueType
Pfam:Dynamin_N 34 57 9.1e-8 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dynamins represent one of the subfamilies of GTP-binding proteins. These proteins share considerable sequence similarity over the N-terminal portion of the molecule, which contains the GTPase domain. Dynamins are associated with microtubules. They have been implicated in cell processes such as endocytosis and cell motility, and in alterations of the membrane that accompany certain activities such as bone resorption by osteoclasts. Dynamins bind many proteins that bind actin and other cytoskeletal proteins. Dynamins can also self-assemble, a process that stimulates GTPase activity. Five alternatively spliced transcripts encoding different proteins have been described. Additional alternatively spliced transcripts may exist, but their full-length nature has not been determined. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a targeted allele die prior to E8-E12. Mice heterozygous for a knock-out allele exhibit muscle atrophy and weakness, intermyofibrillar disorganization, and centrally localized mitochondria and sarcoplasmic reticulum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Dnm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01446:Dnm2 APN 9 21481376 missense probably damaging 1.00
IGL01757:Dnm2 APN 9 21465619 missense probably damaging 1.00
IGL02142:Dnm2 APN 9 21500353 missense probably damaging 1.00
IGL02195:Dnm2 APN 9 21425249 missense probably damaging 1.00
IGL02472:Dnm2 APN 9 21485708 missense possibly damaging 0.55
IGL03161:Dnm2 APN 9 21485724 splice site probably benign
IGL03392:Dnm2 APN 9 21474611 missense probably damaging 1.00
R0302:Dnm2 UTSW 9 21500343 missense probably benign 0.27
R0743:Dnm2 UTSW 9 21500265 missense probably damaging 1.00
R0945:Dnm2 UTSW 9 21505660 missense probably damaging 0.97
R1629:Dnm2 UTSW 9 21504458 missense probably damaging 1.00
R1848:Dnm2 UTSW 9 21505681 missense possibly damaging 0.87
R2084:Dnm2 UTSW 9 21500371 critical splice donor site probably null
R2214:Dnm2 UTSW 9 21485723 critical splice donor site probably null
R2346:Dnm2 UTSW 9 21467556 missense probably damaging 1.00
R3711:Dnm2 UTSW 9 21506373 unclassified probably benign
R3796:Dnm2 UTSW 9 21505487 missense probably benign
R4017:Dnm2 UTSW 9 21494604 missense probably damaging 1.00
R4432:Dnm2 UTSW 9 21491304 intron probably benign
R4583:Dnm2 UTSW 9 21504446 missense probably damaging 1.00
R4604:Dnm2 UTSW 9 21504664 critical splice donor site probably null
R4735:Dnm2 UTSW 9 21474587 missense probably damaging 0.99
R4803:Dnm2 UTSW 9 21474629 missense probably damaging 1.00
R4832:Dnm2 UTSW 9 21474679 splice site probably null
R4836:Dnm2 UTSW 9 21491330 intron probably benign
R4937:Dnm2 UTSW 9 21481337 missense probably benign 0.00
R4948:Dnm2 UTSW 9 21504533 missense possibly damaging 0.90
R5059:Dnm2 UTSW 9 21504578 missense probably damaging 1.00
R5291:Dnm2 UTSW 9 21478907 missense probably damaging 1.00
R5538:Dnm2 UTSW 9 21505627 missense probably benign 0.05
R5613:Dnm2 UTSW 9 21472667 missense probably damaging 1.00
R5805:Dnm2 UTSW 9 21467669 missense probably damaging 0.97
R6253:Dnm2 UTSW 9 21500275 missense probably damaging 1.00
R6586:Dnm2 UTSW 9 21505646 missense probably benign 0.32
R6826:Dnm2 UTSW 9 21504471 nonsense probably null
R6855:Dnm2 UTSW 9 21476585 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACCCAACACAGAAAGTACACAGTGAA -3'
(R):5'- ACACTCTGAAACCAGGAGCCTAACTAA -3'

Sequencing Primer
(F):5'- CACAGTGAAATGTGTTCTAGTAGG -3'
(R):5'- ACTGCAGGATCATGTCCTTG -3'
Posted On2014-05-09