Incidental Mutation 'R1678:Bicc1'
ID188283
Institutional Source Beutler Lab
Gene Symbol Bicc1
Ensembl Gene ENSMUSG00000014329
Gene NameBicC family RNA binding protein 1
SynonymsBic-C, jcpk
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location70922832-71159700 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70943518 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 680 (L680P)
Ref Sequence ENSEMBL: ENSMUSP00000123201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014473] [ENSMUST00000131445] [ENSMUST00000143791]
Predicted Effect probably damaging
Transcript: ENSMUST00000014473
AA Change: L680P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000014473
Gene: ENSMUSG00000014329
AA Change: L680P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131445
AA Change: L598P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119137
Gene: ENSMUSG00000014329
AA Change: L598P

DomainStartEndE-ValueType
SCOP:d1dtja_ 1 46 1e-2 SMART
Blast:KH 1 47 1e-22 BLAST
KH 51 124 6.24e-18 SMART
KH 203 273 1.25e-8 SMART
low complexity region 302 320 N/A INTRINSIC
low complexity region 365 385 N/A INTRINSIC
low complexity region 398 417 N/A INTRINSIC
low complexity region 618 636 N/A INTRINSIC
low complexity region 654 665 N/A INTRINSIC
low complexity region 712 733 N/A INTRINSIC
SAM 790 856 2.04e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000143791
AA Change: L680P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123201
Gene: ENSMUSG00000014329
AA Change: L680P

DomainStartEndE-ValueType
KH 47 129 2.69e0 SMART
KH 133 206 6.24e-18 SMART
KH 285 355 1.25e-8 SMART
low complexity region 384 402 N/A INTRINSIC
low complexity region 447 467 N/A INTRINSIC
low complexity region 480 499 N/A INTRINSIC
low complexity region 700 718 N/A INTRINSIC
low complexity region 736 747 N/A INTRINSIC
low complexity region 794 815 N/A INTRINSIC
SAM 872 938 4.26e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144740
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an RNA-binding protein that is active in regulating gene expression by modulating protein translation during embryonic development. Mouse studies identified the corresponding protein to be under strict control during cell differentiation and to be a maternally provided gene product. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygous inactivation of this gene causes heteroxia, impaired nodal flow, ventricular septal defects, partial prenatal lethality and postnatal death due to renal failure. Chemically induced mutants develop kidney cysts and may show bulging abdomens, bile duct anomalies and cardiovascular defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nsun2 T C 13: 69,627,103 I353T probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Bicc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00961:Bicc1 APN 10 70961157 missense probably damaging 1.00
IGL01988:Bicc1 APN 10 70956176 missense probably damaging 1.00
IGL02686:Bicc1 APN 10 70943360 splice site probably benign
IGL02829:Bicc1 APN 10 70958880 missense probably damaging 1.00
IGL03276:Bicc1 APN 10 70953438 missense possibly damaging 0.76
IGL03354:Bicc1 APN 10 70946602 missense probably benign 0.00
artemis UTSW 10 71027954 missense probably damaging 0.99
Pebbles UTSW 10 70947900 missense possibly damaging 0.95
PIT1430001:Bicc1 UTSW 10 70957681 missense possibly damaging 0.94
R0095:Bicc1 UTSW 10 70961158 missense probably damaging 1.00
R0142:Bicc1 UTSW 10 70925370 missense probably damaging 1.00
R0184:Bicc1 UTSW 10 71079215 missense probably benign
R0469:Bicc1 UTSW 10 71079215 missense probably benign
R0485:Bicc1 UTSW 10 70925315 missense probably damaging 0.96
R0520:Bicc1 UTSW 10 70957190 missense probably damaging 0.96
R0884:Bicc1 UTSW 10 70958847 missense probably damaging 1.00
R1892:Bicc1 UTSW 10 70958784 missense probably damaging 1.00
R1943:Bicc1 UTSW 10 71159523 missense probably damaging 1.00
R2220:Bicc1 UTSW 10 70950125 missense probably damaging 1.00
R2240:Bicc1 UTSW 10 70946803 critical splice donor site probably null
R2519:Bicc1 UTSW 10 70930644 missense probably damaging 1.00
R4362:Bicc1 UTSW 10 70943374 frame shift probably null
R4363:Bicc1 UTSW 10 70943374 frame shift probably null
R4419:Bicc1 UTSW 10 70946974 missense possibly damaging 0.73
R4697:Bicc1 UTSW 10 70953484 missense possibly damaging 0.87
R4728:Bicc1 UTSW 10 70935831 critical splice donor site probably null
R4765:Bicc1 UTSW 10 70940593 missense probably damaging 1.00
R4838:Bicc1 UTSW 10 70945316 missense possibly damaging 0.50
R5022:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5023:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5057:Bicc1 UTSW 10 70947883 missense possibly damaging 0.79
R5082:Bicc1 UTSW 10 70940522 missense probably benign 0.05
R5160:Bicc1 UTSW 10 70932236 missense probably damaging 1.00
R5294:Bicc1 UTSW 10 70947900 missense possibly damaging 0.95
R5639:Bicc1 UTSW 10 70940520 missense probably damaging 1.00
R5749:Bicc1 UTSW 10 70946969 missense probably benign 0.00
R6045:Bicc1 UTSW 10 70957081 nonsense probably null
R6128:Bicc1 UTSW 10 70940483 splice site probably null
R6277:Bicc1 UTSW 10 71027901 missense possibly damaging 0.74
R6389:Bicc1 UTSW 10 70958922 missense probably damaging 1.00
X0028:Bicc1 UTSW 10 70945336 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATTCTTGTCGCTCACAGCAAAACC -3'
(R):5'- TGTGTCTAGCAGGGAGACAGCAAC -3'

Sequencing Primer
(F):5'- TTGAGTGTCACACTGACCAG -3'
(R):5'- AGCAACACCTTTGTCTCAGTG -3'
Posted On2014-05-09