Incidental Mutation 'R1678:Nsun2'
ID188299
Institutional Source Beutler Lab
Gene Symbol Nsun2
Ensembl Gene ENSMUSG00000021595
Gene NameNOL1/NOP2/Sun domain family member 2
SynonymsMisu
MMRRC Submission 039714-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.365) question?
Stock #R1678 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location69533746-69635780 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69627103 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 353 (I353T)
Ref Sequence ENSEMBL: ENSMUSP00000135455 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022087] [ENSMUST00000109699] [ENSMUST00000176485]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022087
AA Change: I322T

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022087
Gene: ENSMUSG00000021595
AA Change: I322T

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 83 209 4.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 199 376 1.1e-23 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109699
AA Change: I388T

PolyPhen 2 Score 0.453 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105321
Gene: ENSMUSG00000021595
AA Change: I388T

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 169 428 3.2e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136891
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136932
Predicted Effect probably damaging
Transcript: ENSMUST00000176485
AA Change: I353T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135455
Gene: ENSMUSG00000021595
AA Change: I353T

DomainStartEndE-ValueType
Pfam:Nol1_Nop2_Fmu 114 240 3.5e-19 PFAM
Pfam:Nol1_Nop2_Fmu 230 399 1.1e-23 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a methyltransferase that catalyzes the methylation of cytosine to 5-methylcytosine (m5C) at position 34 of intron-containing tRNA(Leu)(CAA) precursors. This modification is necessary to stabilize the anticodon-codon pairing and correctly translate the mRNA. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased body size, male sterility, and hair cycle anomalies. Additional phenotypes may include reduced body fat, skeletal, craniofacial and eye defects, abnormal erythropoiesis, and altered energy expenditure and gas, glucose, and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700074P13Rik C A 6: 40,929,519 probably benign Het
4930402H24Rik A G 2: 130,814,273 V105A probably damaging Het
Abca17 A C 17: 24,335,620 I120S probably benign Het
Abcb5 A C 12: 118,965,329 probably benign Het
Abcc4 T A 14: 118,594,894 T775S probably benign Het
Acnat2 T A 4: 49,380,568 Y270F probably damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Ankib1 A G 5: 3,706,301 I548T probably damaging Het
Apbb1ip A T 2: 22,874,880 probably null Het
Asb17 C T 3: 153,844,367 S12F probably damaging Het
Atad2b G A 12: 4,965,899 V542I possibly damaging Het
Atxn7 T C 14: 14,096,239 F515L probably damaging Het
Bicc1 A G 10: 70,943,518 L680P probably damaging Het
Bpifb6 G A 2: 153,908,642 R351H probably damaging Het
C4b A G 17: 34,743,650 F26S probably benign Het
Cadps A G 14: 12,517,802 probably null Het
Capza1 G T 3: 104,864,353 S9* probably null Het
Ccdc129 G T 6: 55,968,514 C740F probably benign Het
Ccl11 C T 11: 82,058,040 P25L probably damaging Het
Cdyl A T 13: 35,856,889 K306N probably damaging Het
Cnga3 T C 1: 37,261,498 V471A possibly damaging Het
Col4a4 T C 1: 82,486,659 K983E unknown Het
Cp A C 3: 19,972,717 K436N probably damaging Het
Csmd1 T A 8: 15,918,252 D3125V possibly damaging Het
Daw1 A T 1: 83,183,366 N143I probably damaging Het
Dmd T A X: 84,974,762 I3067N probably benign Het
Dnah11 T G 12: 117,933,845 N3550T possibly damaging Het
Dnm2 T C 9: 21,467,532 V129A possibly damaging Het
Dync1h1 A T 12: 110,665,662 probably null Het
Efemp1 G A 11: 28,916,942 E325K probably benign Het
Enox1 A G 14: 77,577,656 T85A probably benign Het
Faim2 C A 15: 99,520,336 V123F possibly damaging Het
Fgfr2 T C 7: 130,228,620 probably null Het
Fign T C 2: 63,980,374 E184G probably damaging Het
Fnd3c2 T C X: 106,237,699 T799A probably benign Het
Frem2 T C 3: 53,519,938 D2931G probably damaging Het
Fsip2 A G 2: 82,986,345 T4141A probably benign Het
Gigyf2 T A 1: 87,416,983 M546K probably benign Het
Gm21775 G A Y: 10,553,867 V139M probably damaging Het
Gpr83 G T 9: 14,866,849 V172F probably damaging Het
Jmjd4 A G 11: 59,453,612 Y179C probably damaging Het
Kcnq3 A G 15: 66,031,432 L143P probably damaging Het
Klhl41 T C 2: 69,670,939 V248A probably benign Het
Lama1 T C 17: 67,810,155 Y2482H possibly damaging Het
Lamb2 A T 9: 108,483,686 probably null Het
Lclat1 G A 17: 73,196,720 G162R probably damaging Het
Map6 T C 7: 99,268,098 V26A probably damaging Het
Mdn1 A T 4: 32,663,050 D107V probably damaging Het
Metap1d T A 2: 71,524,777 V304D possibly damaging Het
Naca A G 10: 128,043,526 probably benign Het
Napg T C 18: 62,984,072 probably null Het
Nbeal1 T A 1: 60,260,334 F7L probably benign Het
Ndst2 T C 14: 20,724,514 T825A probably benign Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Nxf3 T C X: 136,075,521 D407G probably damaging Het
Olfr568 T A 7: 102,877,663 V181E probably damaging Het
Olfr891 A T 9: 38,180,637 F62Y possibly damaging Het
Osbpl3 A C 6: 50,336,213 probably null Het
P2rx3 T C 2: 85,022,467 T172A possibly damaging Het
Pcdh10 G T 3: 45,381,881 E877* probably null Het
Pcdhb9 A T 18: 37,401,629 K225N probably damaging Het
Plch1 A G 3: 63,740,694 S419P probably damaging Het
Prex2 T G 1: 11,285,089 I1538S possibly damaging Het
Rasl10a A G 11: 5,059,815 E121G possibly damaging Het
Rbbp8 A G 18: 11,732,315 T754A probably benign Het
Rictor T C 15: 6,756,471 V156A probably benign Het
Ryr1 A T 7: 29,116,154 Y104N probably damaging Het
Sctr G T 1: 120,036,439 probably null Het
Sptbn2 T C 19: 4,750,497 Y2247H probably damaging Het
Sqle C T 15: 59,324,509 R384W probably damaging Het
Srcin1 C A 11: 97,518,644 R1163L probably damaging Het
Srp72 A G 5: 76,980,307 Y125C probably damaging Het
Srrm2 T C 17: 23,818,986 S1535P probably benign Het
Sumf2 A G 5: 129,854,716 E125G possibly damaging Het
Tas2r144 A T 6: 42,215,556 I77F probably benign Het
Tcerg1 T C 18: 42,524,349 S299P unknown Het
Tcp1 T A 17: 12,920,423 N212K probably benign Het
Ttc7 G T 17: 87,361,901 G659C probably damaging Het
Ttn A T 2: 76,861,559 probably null Het
Ubtf A T 11: 102,308,978 D440E probably benign Het
Usp30 A G 5: 114,121,146 D428G probably damaging Het
Vmn2r115 ATCTTCT ATCT 17: 23,359,988 probably benign Het
Vmn2r58 G A 7: 41,864,056 H388Y probably benign Het
Wdr60 A G 12: 116,225,970 S640P probably damaging Het
Zbtb49 T C 5: 38,213,694 D281G probably damaging Het
Zfp248 A G 6: 118,429,804 S174P probably benign Het
Zswim9 T C 7: 13,277,411 T4A probably benign Het
Other mutations in Nsun2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01660:Nsun2 APN 13 69623249 missense probably benign 0.01
IGL01997:Nsun2 APN 13 69623246 missense probably damaging 1.00
IGL02253:Nsun2 APN 13 69619539 missense possibly damaging 0.88
IGL03038:Nsun2 APN 13 69619584 missense probably damaging 1.00
IGL02984:Nsun2 UTSW 13 69543608 intron probably benign
R0601:Nsun2 UTSW 13 69633242 missense probably benign 0.40
R0648:Nsun2 UTSW 13 69627587 missense probably damaging 1.00
R0690:Nsun2 UTSW 13 69629542 missense probably benign
R0718:Nsun2 UTSW 13 69543697 intron probably benign
R1501:Nsun2 UTSW 13 69631587 missense probably damaging 1.00
R1638:Nsun2 UTSW 13 69627586 missense probably damaging 1.00
R1687:Nsun2 UTSW 13 69627597 missense probably damaging 1.00
R2327:Nsun2 UTSW 13 69619581 missense probably benign 0.44
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R2872:Nsun2 UTSW 13 69629682 missense probably damaging 1.00
R3689:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3691:Nsun2 UTSW 13 69612337 missense probably damaging 1.00
R3739:Nsun2 UTSW 13 69629638 missense probably benign
R3918:Nsun2 UTSW 13 69630680 missense probably damaging 1.00
R4065:Nsun2 UTSW 13 69612460 critical splice donor site probably null
R4231:Nsun2 UTSW 13 69619541 missense probably damaging 1.00
R4445:Nsun2 UTSW 13 69629721 splice site probably null
R4872:Nsun2 UTSW 13 69543873 intron probably benign
R5641:Nsun2 UTSW 13 69623249 missense probably benign 0.01
R5718:Nsun2 UTSW 13 69623284 missense probably benign 0.19
R5976:Nsun2 UTSW 13 69623152 splice site probably null
R6110:Nsun2 UTSW 13 69627648 missense probably benign 0.01
R6943:Nsun2 UTSW 13 69630033 missense probably damaging 1.00
R6968:Nsun2 UTSW 13 69631290 missense probably benign 0.00
X0064:Nsun2 UTSW 13 69615519 critical splice donor site probably null
Z1088:Nsun2 UTSW 13 69615465 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACTTCCCCACACAAAATCGTCTG -3'
(R):5'- CGGCACATGGCAGTTTCCAAAG -3'

Sequencing Primer
(F):5'- CAAAATGAAAACCGAGTCCGTG -3'
(R):5'- GGCAGTTTCCAAAGTACTAACTCTG -3'
Posted On2014-05-09